View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_48 (Length: 275)
Name: NF15895_low_48
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 20 - 150
Target Start/End: Complemental strand, 27751129 - 27750999
Alignment:
| Q |
20 |
atgaacagagatgatcacccattatcatttctatatcaagatctatgaagggcgataggtgaatgtataattgaaataagaggagattatagcccgatta |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27751129 |
atgaacagagatgatcacccattatcagttctatatcaagatctatgaagggcgataggtgaatgtataattgaaataagaggagtttatagcccgatta |
27751030 |
T |
|
| Q |
120 |
agtgtttatttttcttgtcagccattaaaag |
150 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |
|
|
| T |
27751029 |
agtgtttacttttcttttcagccattaaaag |
27750999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 26653263 - 26653212
Alignment:
| Q |
52 |
atatcaagatctatgaagggcgataggtgaatgtataattgaaataagagga |
103 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||| |||| |
|
|
| T |
26653263 |
atatcaagatccatgaagggtgataggtgaaggtataattggaataaaagga |
26653212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University