View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_53 (Length: 254)
Name: NF15895_low_53
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 97 - 241
Target Start/End: Original strand, 25830007 - 25830151
Alignment:
| Q |
97 |
tatatagttccttctttctcaaccgtctttcctaaggttccctcaatgtggagtctccactcgtcttcgttgaatcgttctctccccatttttctcccct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25830007 |
tatatagttccttctttctcaaccgtctttcatagggttccctcaatgtggagtctccactcctcttcgttgaatcgttctctccccatttttctcccct |
25830106 |
T |
 |
| Q |
197 |
ctatcgggtacgtagttggactcgccaatgacaaattattcccct |
241 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
25830107 |
ctatcgggtacgtagctggactcgccaatgacagattattcccct |
25830151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 25829930 - 25829976
Alignment:
| Q |
41 |
gatatggttttaaggaaggcaatgtgtttttctgtttatgtgattaa |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25829930 |
gatattgttttaaggaaggcaatgtgtttttctgtttttgtgattaa |
25829976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University