View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15895_low_54 (Length: 251)

Name: NF15895_low_54
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15895_low_54
NF15895_low_54
[»] chr8 (2 HSPs)
chr8 (9-136)||(40109185-40109312)
chr8 (204-238)||(40109083-40109117)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 9 - 136
Target Start/End: Complemental strand, 40109312 - 40109185
Alignment:
9 gttgaattaaagttgaaaggcaagaaagaggcccgcgaggaagttgaattttggtgcgtaaatggtagtgtgaaattgacttgttatcaaacctcataca 108  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40109312 gttgaattaaagtggaaaggcaagaaagaggcccgcgaggaagttgaattttggtgcgtaaatggtagtgtgaaattgacttgttatcaaacctcataca 40109213  T
109 attacaatacctctctaaaccagcaaaa 136  Q
    ||||||||||||||||||||||||||||    
40109212 attacaatacctctctaaaccagcaaaa 40109185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 238
Target Start/End: Complemental strand, 40109117 - 40109083
Alignment:
204 tgttgctccatcctcactcttctaacctgtctctg 238  Q
    ||||||||||||||||||||||||| |||||||||    
40109117 tgttgctccatcctcactcttctaatctgtctctg 40109083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University