View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_57 (Length: 247)
Name: NF15895_low_57
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 17821515 - 17821327
Alignment:
| Q |
1 |
gccttttgtttacatatctatgtcttgttcaactatcaatcaggttagctttttattattttgcttctcattttgaatctatccttttacttttaagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
17821515 |
gccttttgtttacatatctatgtcttgttcaactatcaatcaggttagctttttattattttgcttctcatttttaatctatcctttttcttttaagaga |
17821416 |
T |
 |
| Q |
101 |
ttattagatgttatgctacattttgtcacatgcactatggatagccgctcactaatttatatttccatttccaaataaaattattttga |
189 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17821415 |
ttattagatgttctgctacatttaatcacatgcactatggatagccgctcactaatttatatttccatttccaaataaaattattttga |
17821327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University