View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_64 (Length: 217)
Name: NF15895_low_64
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 2314586 - 2314772
Alignment:
| Q |
17 |
aaattacatgtctgttgaaattccacaagagattggtaaattaacatcatttgaagacttagtgacttataataacttagggtttttctgcttctcttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2314586 |
aaattacatgtctgttgaaattccacaagagattggtaaattaacatcatttgaagacttagtgacttgtaataacttggggtttttctgcttctcttta |
2314685 |
T |
|
| Q |
117 |
ttaggtgctcaattttcataattagaacttcaaattgtttaaagcggtcctttatacaagtctcagcttattgttatatcacctatg |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2314686 |
ttaggtgctcaatttttataattagaacttcaaattgtttaaagcggtcctttatacaagtctcagcttattgttatatcacttatg |
2314772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University