View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_65 (Length: 215)
Name: NF15895_low_65
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 4845284 - 4845105
Alignment:
| Q |
13 |
gattatactcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatgttttt--gcaaattgagttttgacacc |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4845284 |
gattatattcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatttttttttgcaaattgagttttgacacc |
4845185 |
T |
|
| Q |
111 |
tcactgttctattcgaaatataaaaggttccggccatcggacatttaagttgcggttgagatgatgcacttttcttgggg |
190 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4845184 |
tcactgttctatttgaaatataaaaggttccggccatcggacatttaagttgcggttgatatgatgcacttttcttgggg |
4845105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 95
Target Start/End: Complemental strand, 4818893 - 4818834
Alignment:
| Q |
37 |
aaggatcaaatacaaagggatttgtggatgaatcaa-ttagccaagtatgtttttgcaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |||| ||||| |
|
|
| T |
4818893 |
aaggatcaaatacaaagggatttgtggatgaataaatttagccaagtattttttcgcaaa |
4818834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 4814722 - 4814663
Alignment:
| Q |
138 |
ttccggccatcggacatttaagttgcggttgagatgatgcacttttcttggggcaggtaa |
197 |
Q |
| |
|
|||| |||||| ||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4814722 |
ttccagccatctgacatttcagtgacggttgagatgatgcccttttcttggggcaggtaa |
4814663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University