View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_high_19 (Length: 288)
Name: NF15896_high_19
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 17975644 - 17975373
Alignment:
| Q |
1 |
atcattggttaaatgggatgaacctaaagtctcgcaggttccagagcgagtcagtccttgggaggttgaaactatttccgacatatttgcactgcatcca |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17975644 |
atcataggttaaatgggatgaacctaaagtctcgcaggttccagagcgagtcagtccttgggaggttgaaactatttccgacatatttgcactgcatcca |
17975545 |
T |
 |
| Q |
101 |
caattccacccgacnnnnnnnnnnnnnnnntctgatccagattctgctgcattcagtgataaaaagggagactccttcgtcccaaatatagaggcttttt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17975544 |
caattccacccgacaaaaaagcttaaaaaatctgatccagattctgctgcattcagtgataaaaagggagactccttcatcccaaatatagaggcttttt |
17975445 |
T |
 |
| Q |
201 |
tgaagatggtcccaaatatagagtttaaacatttcgtgatgacatcctcgaatcaaacattgttgaacaatg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17975444 |
tgaagatggtcccaaatatagagtttaaacatttcgtgatgacatcctctaatcaaacattgttgaacaatg |
17975373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University