View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_high_24 (Length: 248)
Name: NF15896_high_24
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_high_24 |
 |  |
|
| [»] scaffold0392 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0392 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 31 - 238
Target Start/End: Complemental strand, 15772 - 15565
Alignment:
| Q |
31 |
attcactttaatcaattttttctttgtttattttccatatcttagttttcttcacggagattgagttagattcaatccatcttgcaggcaaagtgcaata |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15772 |
attcactttaatcaattttttctttgtttattttccatatcttagttttcttcacggagattgagttagattcaatccatcttgcaggcaaagtgcaata |
15673 |
T |
 |
| Q |
131 |
atataacttctcacatataaaactttttaatcatttctcaaaaccatgttaagattggcttattggtggctcactttttgttgattttatatataacttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15672 |
atataacttctcacatataaaactttttaatcatttctcaaaaccatgttaagattggcttattggtggctcactttttgttgattttatatataacttt |
15573 |
T |
 |
| Q |
231 |
ttaccttt |
238 |
Q |
| |
|
|||||||| |
|
|
| T |
15572 |
ttaccttt |
15565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University