View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_high_36 (Length: 204)
Name: NF15896_high_36
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 46 - 187
Target Start/End: Complemental strand, 52987181 - 52987040
Alignment:
| Q |
46 |
aagtctgttaattctgaatcttaaattagggttttgctttcaattcccaaatcatcattttcaccttcaattggtgtttgcctagccctatggtctggtc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987181 |
aagtctgttaattctgaatcttaaattagggttttgctttcaattcccaaatcatcattttcaccttcaattggtgtttgcctagccctatggtctggtc |
52987082 |
T |
 |
| Q |
146 |
ggatgataacatccaacaactggaagcaactaagcaaattcg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987081 |
ggatgataacatccaacaactggaagcaactaagcaaattcg |
52987040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 55634683 - 55634723
Alignment:
| Q |
137 |
ggtctggtcggatgataacatccaacaactggaagcaacta |
177 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
55634683 |
ggtctggtccgatgataacaaccaacaactggaagcaacta |
55634723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 177
Target Start/End: Complemental strand, 55660053 - 55660009
Alignment:
| Q |
133 |
ctatggtctggtcggatgataacatccaacaactggaagcaacta |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
55660053 |
ctatggtctggtcggatgataacagccaacagttggaagcaacta |
55660009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 16437653 - 16437693
Alignment:
| Q |
137 |
ggtctggtcggatgataacatccaacaactggaagcaacta |
177 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
16437653 |
ggtctggtccgatgataacaaccaacaactggaagcaacta |
16437693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University