View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_18 (Length: 362)
Name: NF15896_low_18
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 275
Target Start/End: Complemental strand, 52987559 - 52987302
Alignment:
| Q |
16 |
ataaaaaattactttcttcatcatttaataagcacgaaatgacaaaccgaatcaactagacctaatcacacttttaaccttcatgtttctcaatctaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987559 |
ataaaaaattactttcttcatcatttaataagcacgaaatgacaaaccgaatcaactaagcctaatcacacttttaaccttcatgtttctcaatctaaaa |
52987460 |
T |
 |
| Q |
116 |
aattttcactcatataannnnnnngaacgatttaaaccccacatttatttcttttttgatttcaaggtccctcacaaaactttccccaatttgacgatga |
215 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987459 |
aattttcactcata--atttttttgaacgatttaaaccccacatttatttcttttttgatttcaaggtccctcacaaaactttccccaatttgacgatga |
52987362 |
T |
 |
| Q |
216 |
ggtggtgagttttagtgacgtggcatccttgtcactttggcaatgtggatactagtatac |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52987361 |
ggtggtgagttttagtgacgtggcatccttgtcactttgccaatgtggatactagtatac |
52987302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University