View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_22 (Length: 280)
Name: NF15896_low_22
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 278
Target Start/End: Complemental strand, 4524985 - 4524713
Alignment:
| Q |
7 |
attataagatgattttaaaagttcgaacatttcttccctnnnnnnnnnn-gttcaaacatttcttgtgattcgaattacaacttttgcaaaagtagcttc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4524985 |
attataagatgattttaaaagttcgaacatttcttccctaaaaaaaaaaagttcaaacatttcttgtgattcgaattacaacttttgcaaaagtagcttc |
4524886 |
T |
|
| Q |
106 |
tttattaaaattcacccccattacttctctatgaagtttctagagtataacaatttgaaatctttggcattttgcttccaaacgataagctagccactca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4524885 |
tttattaaaattcacccccattacttctctatgaagtttctagagtataacaatttgaaatctttggcattttgcttccaaacgataagctagccactca |
4524786 |
T |
|
| Q |
206 |
aatatggggaccatgttcctactttgttatgctatgcccaacagagcaaatagtgatatttgatttgcctttg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4524785 |
aatatggggaccatgttcctactttgttatgctatgcccaacagagcaaatagtgatatttgatttgcctttg |
4524713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University