View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_23 (Length: 268)
Name: NF15896_low_23
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_23 |
 |  |
|
| [»] scaffold0392 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0392 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 265
Target Start/End: Complemental strand, 16037 - 15787
Alignment:
| Q |
14 |
caacaattacttttctaactaaagcaacctaactgtgatcactccacatttaattttcaaagtgtaacaataaatatggttaacaaggtaccaacaacct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16037 |
caacaattacttttctaactaaagcaacctagctgtgatcactccacatttcattttcaaagtgtaacaataaatatggttaacaaggtaccaacaacct |
15938 |
T |
 |
| Q |
114 |
tggagctcatttgatcacatgtcctaagttccaatatcccaaactggacccaacaatttactttaaacaacnnnnnnncattgcttgctatcgtattgaa |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15937 |
tggagctcatttaatcacatgtcctaagttccaatatcccaaactggacccaacaatttactttaaacaac-aataaacattgcttgctatcgtattgaa |
15839 |
T |
 |
| Q |
214 |
tgacataatcttcaacaaaatagctaaaatataactaatcgtacaaccacca |
265 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| ||||||| |
|
|
| T |
15838 |
tgacataatcttcaacaacatagctaaaatatgactaatcgtaccaccacca |
15787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University