View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_25 (Length: 251)
Name: NF15896_low_25
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 10330797 - 10330578
Alignment:
| Q |
18 |
aaaataacgggtagtgcttcttaaaagaaagtttggtgtttcccttttcagccttttctttattctttatagttgatttcctttcatgaatcccttcccc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10330797 |
aaaataacggatagtgcttcttaaaagaaagtttggtgtttcccttttcagccttttctttattctttatggttgatttcctttcatgaatcccttcccc |
10330698 |
T |
 |
| Q |
118 |
agctttaacgcattaaaata-annnnnnnncttatgcgtcnnnnnnnngtttgtttctttactattaatttttcttgtttgtcaaactaaagagtactcg |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10330697 |
agctttaacgcattaaaatattttttttttcttatgcgtctaaaaaaagtttgtttctttactattaatttttcttgtttgtcaaactaaagagtaatcg |
10330598 |
T |
 |
| Q |
217 |
catttattcattattgtttt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10330597 |
catttattcattattgtttt |
10330578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University