View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_30 (Length: 242)
Name: NF15896_low_30
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 6543944 - 6543735
Alignment:
| Q |
14 |
caaaggagggaattgtgttaggacaaaaccatttagcaaggaagaaatgaacttaaatggtttcattctagagacatatttaacacaagtgaatgaattt |
113 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6543944 |
caaaggagggaattgtgtgaggaaaaaaccatttagcaaggaagaaatgaacctaaatggttacattctagagacatatttaacacaagtgaatgaattt |
6543845 |
T |
 |
| Q |
114 |
aaagtagcacaagaggaagcatcaaagaaaggtttgaaatttttgatgcttaatacaactgaaattatgttgttgagacctgatggacacccaaataact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6543844 |
aaagtagcacaagaggaagcatcaaagaaaggtttgaaatttttgatgctaaatacaactgaaattatgttgttgagacctgatggacaccctaataact |
6543745 |
T |
 |
| Q |
214 |
atggacatgc |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
6543744 |
atggacatgc |
6543735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University