View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15896_low_35 (Length: 227)
Name: NF15896_low_35
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15896_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 29554798 - 29554874
Alignment:
| Q |
141 |
ttctgttgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatctgtgctgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29554798 |
ttctgttgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatttgtgctgct |
29554874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 29554675 - 29554741
Alignment:
| Q |
18 |
aacatggtatcaaaagctttcttcgatccaccttgaactacggtttcacttccattattgagttcct |
84 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29554675 |
aacatggtatcaaaagctttgttcgatccaccttgaactacggtttcacttccattattgagttcct |
29554741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 217
Target Start/End: Complemental strand, 42779863 - 42779794
Alignment:
| Q |
147 |
tgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatctgtgctgct |
217 |
Q |
| |
|
||||||||||| ||| |||||||||| || | |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42779863 |
tgaagaaaattgaatttgttgctttttttt-gctagcaatatgtggtctattcttttgaatttgtgctgct |
42779794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University