View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15897_low_8 (Length: 305)
Name: NF15897_low_8
Description: NF15897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15897_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 39956272 - 39955997
Alignment:
| Q |
14 |
caaaggaagagcaaactgcaaaggttgcaccgattgcaaagagaacaccaccaaaactccatgaaagaaggaaatgcatgaagccaaaacttgagattgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956272 |
caaaggaagagcaaactgcaaaggttgcaccgattacaaagagaacaccaccaaaactccatgaaagaaggaaatgcatgaagccaaaacttgagattgt |
39956173 |
T |
|
| Q |
114 |
taaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcttctaagtcaagaaattctagctttccttcaagtcctgtatcaggtagtggaagt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956172 |
taaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcctctaagtcaagaaattctagctttccttcaagtcctgtatcaggtagtggaagt |
39956073 |
T |
|
| Q |
214 |
tctagtcttcttccaagccctaccacaccttcaacattgttctctcggttaactattatggaagatgaaaagaaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956072 |
tctagtcttcttccaagccctaccacaccttcaacattgttctctcggttaactattatggaagatgaaaagaaac |
39955997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University