View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15897_low_9 (Length: 245)

Name: NF15897_low_9
Description: NF15897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15897_low_9
NF15897_low_9
[»] chr3 (2 HSPs)
chr3 (117-219)||(18868858-18868958)
chr3 (21-114)||(18869007-18869100)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 117 - 219
Target Start/End: Complemental strand, 18868958 - 18868858
Alignment:
117 acttggacacgatgggttagtgatcatgtggtggcatgttgttggcttatacctttatcacaatctgaacgatactactaatgtcaccaaaaaatcattt 216  Q
    |||| ||||||||||||||||||||||  ||||||||||||||||||||  ||||||||||||||||| || ||||||||||||||||||||||||||||    
18868958 acttagacacgatgggttagtgatcatagggtggcatgttgttggctta--cctttatcacaatctgatcgttactactaatgtcaccaaaaaatcattt 18868861  T
217 ggg 219  Q
    |||    
18868860 ggg 18868858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 18869100 - 18869007
Alignment:
21 actacaagggaagaattagaggagagaaataaccgccagctgtagtgtgtgaggagttttttgctttgtttgccaggaagtatgttgttcactg 114  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| | | ||||||| | | || |||||||||||||||    
18869100 actacaagggaagaattagaggaaagaaataaccgccaactgtagtgtgtgaggagtttctcggtttgtttacgatgatgtatgttgttcactg 18869007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University