View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15897_low_9 (Length: 245)
Name: NF15897_low_9
Description: NF15897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15897_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 117 - 219
Target Start/End: Complemental strand, 18868958 - 18868858
Alignment:
| Q |
117 |
acttggacacgatgggttagtgatcatgtggtggcatgttgttggcttatacctttatcacaatctgaacgatactactaatgtcaccaaaaaatcattt |
216 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
18868958 |
acttagacacgatgggttagtgatcatagggtggcatgttgttggctta--cctttatcacaatctgatcgttactactaatgtcaccaaaaaatcattt |
18868861 |
T |
 |
| Q |
217 |
ggg |
219 |
Q |
| |
|
||| |
|
|
| T |
18868860 |
ggg |
18868858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 18869100 - 18869007
Alignment:
| Q |
21 |
actacaagggaagaattagaggagagaaataaccgccagctgtagtgtgtgaggagttttttgctttgtttgccaggaagtatgttgttcactg |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| | | ||||||| | | || ||||||||||||||| |
|
|
| T |
18869100 |
actacaagggaagaattagaggaaagaaataaccgccaactgtagtgtgtgaggagtttctcggtttgtttacgatgatgtatgttgttcactg |
18869007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University