View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_15 (Length: 382)
Name: NF1589_high_15
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 139 - 372
Target Start/End: Original strand, 1571840 - 1572073
Alignment:
| Q |
139 |
gagtcccaattgacccacataaatgaatgatacatgtgggaaccttgaataaataatatttgtgggagcattttaattaattataatactaaaattgtct |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1571840 |
gagtcccaattgacccacagaaatgaatgatacatgtgggagctttgaataaataatacttgtgggagcattttagttaattataatactaaaattgtct |
1571939 |
T |
|
| Q |
239 |
tgatatctttattatttgtcgatgaatgatctttggtagaatcaattcataccctaaaaattgtagatttaactctcgctatcggtccctataagcactc |
338 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
1571940 |
tgatatctttattatttgtcgatgaatgttctttggtagaatcaattcataccccaaaaattgtagatttaactctcgctatcagttcctataagcactc |
1572039 |
T |
|
| Q |
339 |
ttttagctttgatgtttgtcttagtgagcctatg |
372 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
1572040 |
ttttagctttgatgtttgttctagtgagcctatg |
1572073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University