View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_25 (Length: 283)
Name: NF1589_high_25
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 270
Target Start/End: Complemental strand, 36087855 - 36087594
Alignment:
| Q |
9 |
atagtacatgagtatttttcttagtcctcggtatttaggggatgagattcagaaactcgtgaattcattttggtggggctggggtggaaacaacgagagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36087855 |
atagtacatgagtatttttcttagtcctcggtatttaggggatgagattcagaaactcgtgaattcattttggtggggctggggtggaaacaatgagagc |
36087756 |
T |
|
| Q |
109 |
ggtaaactagctttaaggagacaattttcaatgcgaaatggtttttatcatgacaatcagtctcacgaaccatcacgagtgatcttgcccagttcgaagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36087755 |
ggtaaactagctttaaggagacaattttcaatgggaaatggtttttatcgtgacaatcagtctcacgaaccatcacgagtgatcttgcccagttggaagt |
36087656 |
T |
|
| Q |
209 |
caattcttcaatttcatttttaactactcttgtatggttagtggaagatatttaatagtatt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36087655 |
caattcttcaatttcatttttaactactcttgtatggttagtggaagatatttaatagtatt |
36087594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University