View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_38 (Length: 246)
Name: NF1589_high_38
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 25974335 - 25974099
Alignment:
| Q |
7 |
agattaaaatagcatgagggtttgtctctattgttttgannnnnnnnatgttcggtggttgatcttattgttgtaagttatcattctcgat----gaggt |
102 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
25974335 |
agattaaattagcatgagggtttttctctattgttttgattttttt-atgtccggtggttgatcttattgtggtaagttatcattctcgatcgatgaggt |
25974237 |
T |
|
| Q |
103 |
ttaaaacttgatccatttcaaaatggaaaggttttacctaatttttt----atgctcaaaggtggaacgtgttgttgtaagctctcttcctcgatgaggc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
25974236 |
ttaaaacttgatccatttcaaaatggaaaggttttacctaattttttttttatactcaaaggtggaacttgttgtggtaagctctcttcctcgatgaggc |
25974137 |
T |
|
| Q |
199 |
ttaaaatgtatcagttgtgggatgaatttttacctatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25974136 |
ttaaaatgtatcagttgtgggatgaatttttacctatg |
25974099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University