View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_45 (Length: 238)
Name: NF1589_high_45
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 108 - 237
Target Start/End: Original strand, 32710206 - 32710335
Alignment:
| Q |
108 |
ccaccgtatattactcgaactatgtaataaggaattgaggttgaacccagtggagcctctatgtaatcttcaatctatattgattggtcaatttcaatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32710206 |
ccaccgtatattactcgaactatgtaataaggaattgaggttgaacccagtggagcctctatgtaatcttcaatctatattgattggtcaatttcaatga |
32710305 |
T |
 |
| Q |
208 |
taataacaacagtttgttacatccaattct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32710306 |
taataacaacagtttgttacatccaattct |
32710335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 32710099 - 32710128
Alignment:
| Q |
1 |
ataccccctgaatgtagaagagaccgtgac |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32710099 |
ataccccctgaatgtagaagagaccgtgac |
32710128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University