View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_47 (Length: 237)
Name: NF1589_high_47
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 191
Target Start/End: Original strand, 19797159 - 19797206
Alignment:
| Q |
144 |
ttatttatttacttattttgaagaaaaaatgtcacctatatttatcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19797159 |
ttatttatttacttattttgaagaaaaaatgtcacctatatttatcat |
19797206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 191
Target Start/End: Complemental strand, 33545723 - 33545676
Alignment:
| Q |
145 |
tatttatttacttattttgaagaaaaaa-tgtcacctatatttatcat |
191 |
Q |
| |
|
|||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
33545723 |
tatttatttatttattttgaaaaaaaaaatgtcacctatatttatcat |
33545676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 165
Target Start/End: Complemental strand, 33140041 - 33140013
Alignment:
| Q |
137 |
tatttatttatttatttacttattttgaa |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33140041 |
tatttatttatttatttacttattttgaa |
33140013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University