View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_48 (Length: 236)
Name: NF1589_high_48
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 25974623 - 25974840
Alignment:
| Q |
1 |
cttgtcagcgacaaaactctatatggatatgatataccctcgacacttaccgtcaaacataaaaaattctaatgaatatttaacacatgatatagtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25974623 |
cttgtcagcgacaaaactctatatggatatgatataccctcgacacttaccgtcgaacataaaaaattctaatgaatatttaacacatgatatagtaaaa |
25974722 |
T |
|
| Q |
101 |
attatctatttaatttggcatgtcctctccttgtttaaatcacacatagtcatcatttcgaactacaaaatgatggctagggtgggaaacattgtgttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25974723 |
attatctatttaatttggcatgtcctctccttgtttaaatcacacatagtcatcatttcgaactacaaaatgatggctagggtgggaaacattgtgttgg |
25974822 |
T |
|
| Q |
201 |
actagaccaagactcaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25974823 |
actagaccaagactcaaa |
25974840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University