View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_49 (Length: 235)
Name: NF1589_high_49
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_49 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 101 - 235
Target Start/End: Complemental strand, 30856405 - 30856269
Alignment:
| Q |
101 |
gttcattttatagcatgaaa--gatgatgaaatgaagaatacacgtgtggaaaacctagcgccagaatagaagaagctaaagccttcaaggtgcacgttt |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30856405 |
gttcattttatagcatgaaaaagatgatgaaatgaagaatacacgtgtggaaaacctagcgccagaatagaagaagctaaaaccttcaaggtgcacgttt |
30856306 |
T |
 |
| Q |
199 |
ccttgttttgtttttgttcctcttcctcgtacccttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30856305 |
ccttgttttgtttttgttcctcttcctcgtacccttc |
30856269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University