View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_50 (Length: 233)
Name: NF1589_high_50
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 36813037 - 36813257
Alignment:
| Q |
3 |
aattatttaagtaattaaggtacttttgacttttgaccatattgaatttatttctgctctgcaatgttttcacccactcatgtttcaccagacttttgct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36813037 |
aattatttaagtaattaaggtacttttgacttttgaccatattgaatttatttctgctctgcaatgttttcacccactcatgtttcaccagacttttgct |
36813136 |
T |
 |
| Q |
103 |
gatcaacccaaaatccattcactttttatgctatgttctaccatttgctgannnnnnnccctgcttggaaaacaaagctatagccttttactttactttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
36813137 |
gatcaacccaaaatccattcactttttatgctatgttctaccatttgctgatttttttccctgcttggaaaacacaggtatagccttttactttagtttc |
36813236 |
T |
 |
| Q |
203 |
acctattatgatttacctttg |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36813237 |
acctattatgatttacctttg |
36813257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University