View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_55 (Length: 222)
Name: NF1589_high_55
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 16842543 - 16842746
Alignment:
| Q |
1 |
gataattggtactcttgtgagtgtttgagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatattttggttaatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842543 |
gataattggtactcttgtgagtgtttgagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatattttggttaatcg |
16842642 |
T |
|
| Q |
101 |
gagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgatttgttcttgtaaagaggcaggtttgctcgaggatgctgttggaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842643 |
gagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgatttgttcttgtaaagaggcaggtttgctcgaggatgctgttggaat |
16842742 |
T |
|
| Q |
201 |
atat |
204 |
Q |
| |
|
|||| |
|
|
| T |
16842743 |
atat |
16842746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 24209382 - 24209538
Alignment:
| Q |
1 |
gataattggtactcttgtgagtgttt--gagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatattttggttaat |
98 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24209382 |
gataattggtactcttgtgagtgtttatgagagggctgggaaagtttatgagttgccgcgtttgcttaaaggttcgttttatcggtatattttggttaat |
24209481 |
T |
|
| Q |
99 |
cggagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgat |
155 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24209482 |
cagagctgttgttccactgtggttatggcttatgtgaagaataagttggtggatgat |
24209538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 204
Target Start/End: Original strand, 24209606 - 24209658
Alignment:
| Q |
152 |
tgatttgttcttgtaaagaggcaggtttgctcgaggatgctgttggaatatat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24209606 |
tgatttgttcttgtaaagaggcaggtttgcttgaggatgctgttggaatatat |
24209658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University