View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_62 (Length: 203)
Name: NF1589_high_62
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 32579647 - 32579815
Alignment:
| Q |
16 |
aatactcattgtgagattcgttcatcgcagcacaacggcatggacgtagacaaatctacctgggcattggataataagaattaagctcttcccagtaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32579647 |
aatactcattgtgagattcgttcatcgcagcacaacggcatggacgtagacaaatctacctgggcattggatgataagaattaagctcttcccagtaaaa |
32579746 |
T |
 |
| Q |
116 |
ttagagacttggaatgtggagtaacttgcaactaattattagtgacttggaatacaagtaagctaagta |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32579747 |
ttagagacttggaatgtggagtaacttgcaactaattattagtgacttggaatacaagtaagctaagta |
32579815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University