View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1589_high_62 (Length: 203)

Name: NF1589_high_62
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1589_high_62
NF1589_high_62
[»] chr1 (1 HSPs)
chr1 (16-184)||(32579647-32579815)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 32579647 - 32579815
Alignment:
16 aatactcattgtgagattcgttcatcgcagcacaacggcatggacgtagacaaatctacctgggcattggataataagaattaagctcttcccagtaaaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
32579647 aatactcattgtgagattcgttcatcgcagcacaacggcatggacgtagacaaatctacctgggcattggatgataagaattaagctcttcccagtaaaa 32579746  T
116 ttagagacttggaatgtggagtaacttgcaactaattattagtgacttggaatacaagtaagctaagta 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32579747 ttagagacttggaatgtggagtaacttgcaactaattattagtgacttggaatacaagtaagctaagta 32579815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University