View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_high_9 (Length: 418)
Name: NF1589_high_9
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_high_9 |
 |  |
|
| [»] chr1 (48 HSPs) |
 |  |
|
| [»] chr7 (53 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] chr5 (48 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] chr2 (56 HSPs) |
 |  |
|
| [»] chr8 (43 HSPs) |
 |  |
|
| [»] chr4 (58 HSPs) |
 |  |
|
| [»] chr3 (50 HSPs) |
 |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |
|
| [»] chr6 (24 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 48)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 9 - 418
Target Start/End: Original strand, 50638545 - 50638952
Alignment:
| Q |
9 |
ataatactaatggcaagaggcaattgaaattaaacaatttgggtttcaccacatccaagaggagaaccgaagaaatagaatcaagtggtaaagggcgttc |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50638545 |
ataataataatggcaagaggcaattgaaattaaacaatttgggtttcaccacatccaagagaagaaccgaagaaatagaatcaagtggtaaagggcgttc |
50638644 |
T |
 |
| Q |
109 |
taggttttttcaggctcggaaacttgagcacctcactcatttctaaaaatgatgcctgattgttgtctttgcattatcaaagtaatttatagctatttga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50638645 |
taggttttttcaggctcggaaacttgagcacctcactcatttctaaaaatgatgcctgattgttgtctttgcattatcaaagtaatttatagctatttga |
50638744 |
T |
 |
| Q |
209 |
aattttagaatattggagagcattttgtgcacatacatatgctttgtatgatgattctctcgcacccagtctaactagatgtgtactagtgttgagttaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50638745 |
aattttagaatattggagagcattttgtgtacatacatatgctttgtatgatgattctctcgcacccagtctaactagatgtgtactagtgttgagttaa |
50638844 |
T |
 |
| Q |
309 |
tttaattagtttgattgatatatgttgaattttaatccaccttggacannnnnnnngttgttggtggtgtccgggattcgaaccctggaccttgcatata |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50638845 |
tttaattagtttgattgatatatgttgaattttaatccaccttggacattttttt--ttgttggtggtggccgggattcgaaccctggaccttgcatata |
50638942 |
T |
 |
| Q |
409 |
ttatgcattg |
418 |
Q |
| |
|
|||||||||| |
|
|
| T |
50638943 |
ttatgcattg |
50638952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 38448853 - 38448902
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38448853 |
ttggtggtgtccgggattcgaaccccggaccttgcatatattatgcattg |
38448902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 5907873 - 5907824
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
5907873 |
ttggtggtgtccggggtttgaaccctggaccttgcatatattatgcattg |
5907824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 23405345 - 23405394
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405345 |
ttggtggtggtcgggattcgaaccctggaccttgcatatattatgcattg |
23405394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 37045133 - 37045182
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37045133 |
ttggtggtgtctggggttcgaaccctggaccttgcatatattatgcattg |
37045182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 35474026 - 35473978
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35474026 |
ttggtggtgtccggggttcgaaccctgaaccttgcatatattatgcatt |
35473978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 17284022 - 17283976
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
17284022 |
gtggtgtccagggttcgaaccctggaccttgcatatattatgcattg |
17283976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 21638187 - 21638138
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
21638187 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcattg |
21638138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 3136678 - 3136724
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
3136678 |
gtggtgtccggaattcgaaccctagaccttacatatattatgcattg |
3136724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 8210375 - 8210421
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
8210375 |
gtggtggccggggttcgaaccctggaccttgtatatattatgcattg |
8210421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 41973326 - 41973280
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattg |
41973280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 46040558 - 46040608
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46040558 |
ttggtggtgtccggggttcgaacccgggaccttgcatatatttatgcattg |
46040608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 9413872 - 9413823
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
9413872 |
ttggtggcgtccgggattcgaaccccgaaccttacatatattatgcattg |
9413823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 17249038 - 17248997
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17249038 |
ttggtggtgtctgggattcgaacccgggaccttgcatatatt |
17248997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 23730366 - 23730407
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
23730366 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatt |
23730407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 47528434 - 47528483
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
47528434 |
ttggtggtgtccggggttcgaacctcggaccttgcgtatattatgcattg |
47528483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 47719094 - 47719142
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
47719094 |
ttggtggtggccgggattcgaactccgaaccttgcatatattatgcatt |
47719142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 383 - 418
Target Start/End: Complemental strand, 40613083 - 40613048
Alignment:
| Q |
383 |
gattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40613083 |
gattcgaaccccggaccttgcatatattatgcattg |
40613048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 3265120 - 3265070
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3265120 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
3265070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 6000133 - 6000179
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcattg |
6000179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 9639807 - 9639853
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| | ||||||| | |||||||||||||||||||||||| |
|
|
| T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcattg |
9639853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 11583160 - 11583110
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
11583160 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
11583110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 17585519 - 17585469
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
17585519 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
17585469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 24529759 - 24529713
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
24529759 |
ttggtggtggccgggattcgaaccccggaccttacatattttatgca |
24529713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 25659881 - 25659931
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
25659881 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
25659931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 29506890 - 29506852
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29506890 |
cggggttcgaaccctggaccttgcatatattatgtattg |
29506852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 33642614 - 33642564
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33642614 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
33642564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 33831996 - 33832046
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33831996 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
33832046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 33894158 - 33894208
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33894158 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
33894208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 33895288 - 33895338
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33895288 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
33895338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 34078282 - 34078244
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34078282 |
gtggtgtccgggattcgaacccgcgaccttgcatatatt |
34078244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 36165592 - 36165642
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
36165592 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
36165642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 40432274 - 40432324
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
40432274 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
40432324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 43120850 - 43120900
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
43120850 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
43120900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 45104184 - 45104134
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45104184 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
45104134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 418
Target Start/End: Complemental strand, 45481560 - 45481518
Alignment:
| Q |
376 |
tgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
45481560 |
tgtccggagttcgaaccccggaccttgcatatattatgcattg |
45481518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 46588162 - 46588212
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46588162 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
46588212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 389 - 418
Target Start/End: Original strand, 9929238 - 9929267
Alignment:
| Q |
389 |
aaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9929238 |
aaccctggaccttgcatatattatgcattg |
9929267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Original strand, 13615603 - 13615648
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
13615603 |
tggtgttcggggttcgaaccttggaccttgcatgtattatgcattg |
13615648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 19620650 - 19620601
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
19620650 |
ttggtggtgtccaagatttgaaccccggaccttgcatatattatgtattg |
19620601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 21400011 - 21400059
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
21400011 |
ttggtggtgtcaggg-ttcgaacccaagaccttgcatatattatgcattg |
21400059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Complemental strand, 30795759 - 30795726
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
30795759 |
ttcgaaccttggaccttgcatatattatgcattg |
30795726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 33373891 - 33373932
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
33373891 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatt |
33373932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 34521177 - 34521226
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||| | || |||||| |||||||||||||||||||||||| |
|
|
| T |
34521177 |
ttggtggtggccgaggtttgaaccccggaccttgcatatattatgcattg |
34521226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 42888649 - 42888600
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | ||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
42888649 |
ttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattg |
42888600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 51503753 - 51503704
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
51503753 |
ttggtggtggccggcgttcgaaccctagaccttggatatattatgcattg |
51503704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 26256076 - 26256124
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||| |||| || ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26256076 |
ttggtggagtccagggttcgaaccccggatcttgcatatattatgcatt |
26256124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 373 - 417
Target Start/End: Original strand, 45418054 - 45418098
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
45418054 |
tggtgtccggagttcgaatcctgaaccttgcatatattatgcatt |
45418098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 53)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 370 - 418
Target Start/End: Original strand, 47155092 - 47155140
Alignment:
| Q |
370 |
tggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47155092 |
tggtggtgtccggggttcgaaccctggaccttgcatatattatgcattg |
47155140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 366 - 418
Target Start/End: Complemental strand, 45425530 - 45425478
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
45425530 |
ttgttggtggtggccgggattcgaaccccgaaccttgcatatattatgcattg |
45425478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 371 - 418
Target Start/End: Complemental strand, 46987158 - 46987111
Alignment:
| Q |
371 |
ggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggaccttgcatatattatgcattg |
46987111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 375 - 418
Target Start/End: Original strand, 29237550 - 29237593
Alignment:
| Q |
375 |
gtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
29237550 |
gtgtccgaggttcgaaccctggaccttgcatatattatgcattg |
29237593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 37624614 - 37624568
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattg |
37624568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 48527261 - 48527215
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcattg |
48527215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 372 - 409
Target Start/End: Original strand, 1398385 - 1398422
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatat |
409 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1398385 |
gtggtgtccgggattcgaaccctggaccgtgcatatat |
1398422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 2618753 - 2618704
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2618753 |
ttggtggtgtatgagattcgaaccccggaccttgcatatattatgcattg |
2618704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 7872735 - 7872784
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
7872735 |
ttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattg |
7872784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 8084501 - 8084452
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
8084501 |
ttggtggtggccggggttcgaaccccggaccttgcatattttatgcattg |
8084452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 18714522 - 18714473
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| |||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
18714522 |
ttggtggtgtacggggtttgaaccccggaccttgcatatattatgcattg |
18714473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 20135148 - 20135189
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
20135148 |
ttggtggtgtccggggttcgaacccgggaccttgcatatatt |
20135189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 33473508 - 33473557
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || || || ||||||||||||||||||||||||||||||| |
|
|
| T |
33473508 |
ttggtggtggccagggttggaaccctggaccttgcatatattatgcattg |
33473557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 417
Target Start/End: Complemental strand, 2648330 - 2648298
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2648330 |
ttcgaaccctggaccttgcatatattatgcatt |
2648298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 21322249 - 21322201
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
21322249 |
ttggtggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Complemental strand, 3830123 - 3830093
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3830123 |
gaaccctggaccttgcatatattatgcattg |
3830093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 4400137 - 4400187
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
4400137 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
4400187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 10999114 - 10999064
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
10999114 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
10999064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 14671233 - 14671195
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14671233 |
cgggattcgaaccccggaccttgtatatattatgcattg |
14671195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 17278156 - 17278106
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
17278156 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
17278106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Complemental strand, 18023734 - 18023704
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18023734 |
gaaccctggaccttgcatatattatgcattg |
18023704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 18956369 - 18956419
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
18956369 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
18956419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 20243330 - 20243280
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcata-tattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||| |||||||||||| |
|
|
| T |
20243330 |
ttggtggtgtccggggttcaaaccccggaccttgcatattattatgcattg |
20243280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 22777350 - 22777395
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
22777350 |
gtggtggccgggattcgaaccccg-accttgcatatattatgcattg |
22777395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 27031300 - 27031350
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27031300 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatttatgcattg |
27031350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 27462426 - 27462472
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
27462472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 29448788 - 29448838
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29448788 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatttatgcattg |
29448838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 38045659 - 38045609
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
38045659 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
38045609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 40239968 - 40240018
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
40239968 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
40240018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 41029335 - 41029297
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
41029335 |
cgggattcgaaccccggaccttgcatatattatacattg |
41029297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 45620651 - 45620601
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45620651 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
45620601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 2916176 - 2916127
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
2916176 |
ttggtgatgtccggggttcgaatcccagaccttgcatatattatgcattg |
2916127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 409
Target Start/End: Complemental strand, 5804832 - 5804795
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatat |
409 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
5804832 |
gtggtggccggggttcgaaccctggaccttgcatatat |
5804795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 6384925 - 6384876
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
6384925 |
ttggtggtgtctagggttcgaaccccagaccttgcatatattatgcattg |
6384876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Original strand, 6768698 - 6768743
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
6768698 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcattg |
6768743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 8227423 - 8227374
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || |||||||||||||||| || |||||||||||||||| |
|
|
| T |
8227423 |
ttggtggtggtcgagattcgaaccctggactttacatatattatgcattg |
8227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 10236892 - 10236941
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||| ||||||||||| |
|
|
| T |
10236892 |
ttggtggtgtccggggttcgaacctcgaaccttgcatacattatgcattg |
10236941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 388 - 417
Target Start/End: Complemental strand, 10242535 - 10242506
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10242535 |
gaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 16198454 - 16198409
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||| ||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16198454 |
gtggtggccgagattcgaactccggaccttgcatatattatgcatt |
16198409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 19416588 - 19416539
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| |||||||||| |
|
|
| T |
19416588 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattg |
19416539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 20103441 - 20103490
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||| | ||||||||||||| |
|
|
| T |
20103441 |
ttggtggtgtctggggttcgaaccccggaccttgtaaatattatgcattg |
20103490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Original strand, 22690026 - 22690071
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcatt |
22690071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 26009347 - 26009302
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
26009347 |
gtggtgtccggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 388 - 417
Target Start/End: Original strand, 26717934 - 26717963
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26717934 |
gaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Original strand, 26973774 - 26973819
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
26973774 |
gtggtgtccgggattcaaacgccggaccttacatatattatgcatt |
26973819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 27772220 - 27772269
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || |||||| ||| || |||||||||||||||||||| |
|
|
| T |
27772220 |
ttggtggtgtccagggttcgaatcctagatcttgcatatattatgcattg |
27772269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 36769225 - 36769184
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36769225 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatt |
36769184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 380 - 417
Target Start/End: Original strand, 37495916 - 37495953
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37495916 |
cgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 39043829 - 39043780
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | | ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39043829 |
ttggtggtgactgcgattcgaaccccggacctagcatatattatgcattg |
39043780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 374 - 415
Target Start/End: Original strand, 47542974 - 47543015
Alignment:
| Q |
374 |
ggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
47542974 |
ggtgtccgggattcgaaccctggcccctgcataaattatgca |
47543015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 373 - 417
Target Start/End: Original strand, 2962717 - 2962761
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||| ||||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
2962717 |
tggtggccgggattcaaaccccgaaccttgcatatattatgcatt |
2962761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 378 - 418
Target Start/End: Complemental strand, 6781872 - 6781832
Alignment:
| Q |
378 |
tccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
6781872 |
tccggggtttgaaccctggaccttgcatattttatgcattg |
6781832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 413
Target Start/End: Original strand, 23069844 - 23069888
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatg |
413 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23069844 |
ttggtggtgtccggggttcgaaccccataccttgcatatattatg |
23069888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 25463 - 25414
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25463 |
ttggtggtgtctggggttcgaaccctggaccttgcatatattatgcattg |
25414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 48)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 32339809 - 32339760
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32339809 |
ttggtggtggccgggattcgaaccccggaccttgcatatattatgcattg |
32339760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 6624850 - 6624801
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
6624850 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgcattg |
6624801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 16531262 - 16531311
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
16531262 |
ttggtggtgtccggaattcgaactatggaccttgcatatattatgcattg |
16531311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 413
Target Start/End: Original strand, 1476101 - 1476141
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatg |
413 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1476101 |
tggtgtccgggattcgaaccctgaaccttgcatatattatg |
1476141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 32675284 - 32675329
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32675284 |
gtggtgtccgg-attcgaaccctagaccttgcatatattatgcattg |
32675329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 35109471 - 35109425
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35109471 |
gtggtgtccgggattcgaacctcggaccttgcatatattatgtattg |
35109425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 43108640 - 43108594
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43108640 |
gtggtgtccaagattcgaaccctgaaccttgcatatattatgcattg |
43108594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 3445234 - 3445283
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3445234 |
ttggtggtggccgggatttgaaccccggaccttgcatacattatgcattg |
3445283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 22522788 - 22522837
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
22522788 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
22522837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 26655538 - 26655489
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
26655538 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattg |
26655489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 26927123 - 26927074
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
26927123 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattg |
26927074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 27679569 - 27679524
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
27679569 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcatt |
27679524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 31708133 - 31708182
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
31708133 |
ttggtggtgtccgaggttcgaaccccagaccttgcatatattatgcattg |
31708182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 31958455 - 31958496
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31958455 |
ttggtggtgtccggggttcgaaccccggaccttgcatatatt |
31958496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 43396928 - 43396879
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||| |||||||||||||||| |
|
|
| T |
43396928 |
ttggtggtgtccgggaatcgaacaccggaccttacatatattatgcattg |
43396879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 373 - 417
Target Start/End: Complemental strand, 3671288 - 3671244
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
3671288 |
tggtatccggggttcgaaccctggaccttgcatatattatacatt |
3671244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 11017250 - 11017202
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11017250 |
ttggcggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
11017202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 366 - 418
Target Start/End: Complemental strand, 26377043 - 26376991
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
26377043 |
ttgttggtggtgtccggagttcgaaccccggacgttgcatataatatgcattg |
26376991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 42005179 - 42005131
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42005179 |
ttggtggtgtccgagattcaaaccccagaccttgcatatattatgcatt |
42005131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 789098 - 789148
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
789098 |
ttggtggtgtccgggattcgaacccgcgaccttgtatatatttatgcattg |
789148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 8350741 - 8350695
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8350741 |
gtggtggccgagattcgaaccctagactttgcatatattatgcattg |
8350695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 414
Target Start/End: Complemental strand, 14474905 - 14474863
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgc |
414 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
14474905 |
gtggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 16050845 - 16050895
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
16050845 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
16050895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 24027931 - 24027981
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
24027931 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
24027981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 24758983 - 24758933
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
24758983 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatttatgcattg |
24758933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 415
Target Start/End: Original strand, 25603991 - 25604033
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
25603991 |
tggtggccgggattcgaaccccgaaccttgcatatattatgca |
25604033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 28207203 - 28207157
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28207203 |
gtggtggccgggattcgaacctcggaccttgcatattttatgcattg |
28207157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 28604408 - 28604454
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
28604408 |
gtggtgtccgtgattcgaaccccggaccttacatttattatgcattg |
28604454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 29383799 - 29383849
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29383799 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
29383849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 31939906 - 31939956
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
31939906 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
31939956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 32261786 - 32261836
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
32261786 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
32261836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 34702561 - 34702515
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| || |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34702561 |
gtggtggccaggattcgaaccccggacctttcatatattatgcattg |
34702515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 35413027 - 35412982
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
35413027 |
gtggtggccggggttcgaaccc-ggaccttgcatatattatgcattg |
35412982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 37932401 - 37932355
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| || || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattg |
37932355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 40715939 - 40715985
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
40715985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 42416800 - 42416750
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||| | ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
42416800 |
ttggtggtgtccgaggttcgaacccgggaccttgcatatatttatgcattg |
42416750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 6489081 - 6489032
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
6489081 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattg |
6489032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 15889485 - 15889436
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
15889485 |
ttggtggtggtcggggtttgaaccctagaccttgcatatattatgcattg |
15889436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 17046407 - 17046359
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
17046407 |
ttggtggtggccgggattcgaactc-ggatcttgcatatattatgcattg |
17046359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 18872738 - 18872693
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||| || |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18872738 |
gtggtgaccaggattcgaaccccgaaccttgcatatattatgcatt |
18872693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 22499011 - 22498967
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
22499011 |
tggtgtccggggttcgaacccag-accttgcatatattatgcattg |
22498967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 26590781 - 26590732
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
26590781 |
ttggtagtggccgggattcaaaccccagaccttgcatatattatgcattg |
26590732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 29874740 - 29874781
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
29874740 |
ttggtggtgtccgggattcgaacccgcgacctttcatatatt |
29874781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 31159499 - 31159454
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||| |||| |
|
|
| T |
31159499 |
tggtgtccggggttcgaaccctgaatcttgcatatattatgtattg |
31159454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 36683457 - 36683506
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
36683457 |
ttggtggtgtctgggattcgaaccccatatcttgcatatattatgcattg |
36683506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 42168932 - 42168981
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
42168932 |
ttggtggtgtctggggttcgaaccccagaccttgcatatactatgcattg |
42168981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 42708045 - 42708000
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
42708045 |
tggtggccgggattcgaatcccagaccttgcatatattatgcattg |
42708000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 370 - 418
Target Start/End: Original strand, 13580730 - 13580778
Alignment:
| Q |
370 |
tggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
13580730 |
tggtgatgtccgggattcgaaccccagaccttgtatatattaggcattg |
13580778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 75396 - 75350
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattg |
75350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 56)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 20455962 - 20455916
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattg |
20455916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 41778931 - 41778980
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41778931 |
ttggtggtggccgggattcgaacctcggaccttgcatatattatgcattg |
41778980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 20120711 - 20120757
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
20120711 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattg |
20120757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 20200776 - 20200730
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattg |
20200730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 417
Target Start/End: Complemental strand, 20239411 - 20239369
Alignment:
| Q |
375 |
gtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20239411 |
gtgtccgggattcgaaccttagaccttgcatatattatgcatt |
20239369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 27411166 - 27411120
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
27411166 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 3079719 - 3079678
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3079719 |
ttggtggtgtccgggattcgaacccgcgaccttgcatatatt |
3079678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 4056864 - 4056815
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4056864 |
ttggtggtgcccgagattcgaactccggaccttgcatatattatgcattg |
4056815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 24593450 - 24593401
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| | || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24593450 |
ttggtggtgttcagggttcgaaccccggaccttgcatatattatgcattg |
24593401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 418
Target Start/End: Original strand, 25598565 - 25598598
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25598565 |
ttcgaaccctggaccttgcatatattatgcattg |
25598598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 28771656 - 28771607
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
28771656 |
ttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcattg |
28771607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 29544701 - 29544652
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
29544701 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
29544652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 366 - 418
Target Start/End: Original strand, 16204801 - 16204853
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
16204801 |
ttgttggtgatgtccgggatccaaaccccagaccttgcatatattatgcattg |
16204853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 27152427 - 27152379
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
27152427 |
ttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcatt |
27152379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 27848232 - 27848184
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
27848232 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 32091158 - 32091206
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||| | ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
32091158 |
ttggtggtgtctgagattcaaaccctagaccttgcatatattatgcatt |
32091206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 379 - 418
Target Start/End: Original strand, 6579278 - 6579317
Alignment:
| Q |
379 |
ccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6579278 |
ccgggattcgaaccccagaccttgcatatattatgcattg |
6579317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 416
Target Start/End: Original strand, 10735818 - 10735865
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
10735818 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 416
Target Start/End: Complemental strand, 16390677 - 16390630
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
16390677 |
ttggtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 660828 - 660858
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
660828 |
gaaccctggaccttgcatatattatgcattg |
660858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 1835689 - 1835639
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
1835689 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
1835639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 2257042 - 2256996
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattg |
2256996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 3324335 - 3324385
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3324335 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
3324385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 7233027 - 7232977
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7233027 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
7232977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 7274671 - 7274633
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7274671 |
gtggtgtccgggattcgaacccaggaccatgcatatatt |
7274633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 8878123 - 8878073
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
8878123 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
8878073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 10065544 - 10065498
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || ||||||||||| | |||||||||||||||||||| |
|
|
| T |
10065544 |
gtggtgtccagggttcgaaccctgaaacttgcatatattatgcattg |
10065498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 13410711 - 13410673
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
13410711 |
cgggattcgaaccttggaccttgcatatattatgtattg |
13410673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 20313305 - 20313355
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
20313305 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
20313355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 21258687 - 21258641
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
21258687 |
gtggtggccgggattcgaaccccagaccttgcatatatcatgcattg |
21258641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 23250326 - 23250356
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23250326 |
gaaccctggaccttgcatatattatgcattg |
23250356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 24393316 - 24393270
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcattg |
24393270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 24579674 - 24579704
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24579674 |
gaaccctggaccttgcatatattatgcattg |
24579704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 29809397 - 29809351
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
29809397 |
gtggtggccgggattcgaaccccgtacctttcatatattatgcattg |
29809351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 31972286 - 31972236
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
31972286 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
31972236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Complemental strand, 32458357 - 32458327
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32458357 |
gaaccctggaccttgcatatattatgcattg |
32458327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 3243367 - 3243408
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3243367 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatt |
3243408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 4531484 - 4531436
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
4531484 |
ttggtggtgtcctgtgttcgaacc-tggaccttgcatatattatgcattg |
4531436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Original strand, 6723080 - 6723113
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
6723080 |
ttcgaaccctggaccttgcatatattatacattg |
6723113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 9718464 - 9718419
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||| ||||||||||||| |
|
|
| T |
9718464 |
tggtgtccgggatttgaactctggaacttgcaaatattatgcattg |
9718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Complemental strand, 12124603 - 12124570
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
12124603 |
ttcgaaccccggaccttgcatatattatgcattg |
12124570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 376 - 417
Target Start/End: Complemental strand, 12231944 - 12231903
Alignment:
| Q |
376 |
tgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
12231944 |
tgtccggggttcaaactctggaccttgcatatattatgcatt |
12231903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 22607223 - 22607178
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
22607223 |
gtggtgtccggggctcgaaccccggaccttacatatattatgcatt |
22607178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 24548085 - 24548036
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || ||||||||| |||||||| |||||||||| |||| |
|
|
| T |
24548085 |
ttggtggtgtccagggttcgaaccccggaccttgaatatattatggattg |
24548036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 24592833 - 24592882
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
24592833 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattg |
24592882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 25395429 - 25395478
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
25395429 |
ttggtggtggtcgggatttgaaccttgaaccttgcatatattatgcattg |
25395478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 32844934 - 32844889
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||| ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
32844934 |
gtggtgtctggggttcgaaccgtggaccttacatatattatgcatt |
32844889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 33064060 - 33064011
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
33064060 |
ttggtggtggccggagttcgaactccggaccttgcatatattatgcattg |
33064011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Original strand, 35685064 - 35685097
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
35685064 |
ttcgaaccctagaccttgcatatattatgcattg |
35685097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 36474836 - 36474787
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||| ||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
36474836 |
ttggtggtggccggaatttgaaccccggaccttgcatattttatgcattg |
36474787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 40202217 - 40202176
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
40202217 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatt |
40202176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 42791369 - 42791320
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
42791369 |
ttggtagtggccggggtttgaaccccggaccttgcatatattatgcattg |
42791320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 15654857 - 15654904
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
15654857 |
ttggtggtgtccggg-ttcgaaccccagaccttgcatattttatgcatt |
15654904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 418
Target Start/End: Original strand, 25274813 - 25274865
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||||| |||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
25274813 |
ttgttagtggtgttcggggttcgaaccccagaccttacatatattatgcattg |
25274865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 31477045 - 31476997
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| |||||||| |||||| | |||||| |||||||||||||| |
|
|
| T |
31477045 |
ttggtggtggccgggatttgaaccccgaaccttgtatatattatgcatt |
31476997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 416
Target Start/End: Complemental strand, 37852065 - 37852037
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37852065 |
gaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 43)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 19778139 - 19778090
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19778139 |
ttggtggtgtctaggattcgaaccccggaccttgcatatattatgcattg |
19778090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 416
Target Start/End: Original strand, 30176406 - 30176453
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
30176406 |
ttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 376 - 418
Target Start/End: Original strand, 1877656 - 1877698
Alignment:
| Q |
376 |
tgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1877656 |
tgtccgggattcgaacccgtgaccttgcatatattatgcattg |
1877698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 8881346 - 8881300
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattg |
8881300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 36059348 - 36059398
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt-atgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36059348 |
ttggtggtgtccggggttcgaaccctcgaccttgcatatattgatgcattg |
36059398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 12748975 - 12748926
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
12748975 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
12748926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 29499845 - 29499796
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
29499845 |
ttggtggtgtttggggttcgaaccctggaccttgcatattttatgcattg |
29499796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 31832077 - 31832126
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||| || |||| ||||||||||||||||||| |
|
|
| T |
31832077 |
ttggtggtgtccggggttcgaaacccggacattgcatatattatgcattg |
31832126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 32051519 - 32051568
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
32051519 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
32051568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 44975252 - 44975203
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||| || | |||||||||||||||||||||| |
|
|
| T |
44975252 |
ttggtggtgtccgggtttcgaatcccgaaccttgcatatattatgcattg |
44975203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 379 - 418
Target Start/End: Original strand, 33482146 - 33482185
Alignment:
| Q |
379 |
ccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
33482146 |
ccgggatttgaaccctggaccttgcataaattatgcattg |
33482185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 1244695 - 1244741
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
1244695 |
gtggtgtccggggttcgaaccccagaccttgtatatattatgcattg |
1244741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 4830071 - 4830033
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4830071 |
cgggattcgaaccccgaaccttgcatatattatgcattg |
4830033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 7553750 - 7553704
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
7553750 |
gtggtgtccggagtttgaaccttggaccttgcatatattatgcattg |
7553704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 14718869 - 14718819
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
14718869 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatttatgcattg |
14718819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 17046081 - 17046131
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
17046081 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
17046131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 19488371 - 19488325
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
19488371 |
gtggtgtccgggattcgagccccagaccttgtatatattatgcattg |
19488325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 27467714 - 27467664
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27467714 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
27467664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 418
Target Start/End: Complemental strand, 33763874 - 33763840
Alignment:
| Q |
384 |
attcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
33763874 |
attcgaaccctgtaccttgcatatattatgcattg |
33763840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 34805791 - 34805741
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
34805791 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
34805741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 35198527 - 35198573
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35198527 |
gtggtgaccggggttcgaactctgaaccttgcatatattatgcattg |
35198573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 39685425 - 39685375
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
39685425 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
39685375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 41360992 - 41360942
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
41360992 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
41360942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 43818035 - 43818085
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
43818035 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
43818085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 44908495 - 44908457
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
44908495 |
gtggtgtccgggattcgaacccaggaccatgcatatatt |
44908457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 7219381 - 7219340
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
7219381 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatt |
7219340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Complemental strand, 7718758 - 7718725
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
7718758 |
ttcgaaccttggaccttgcatatattatgcattg |
7718725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Original strand, 7839108 - 7839153
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7839108 |
gtggtgttcgggattcgaaccccataccttgcatatattatgcatt |
7839153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 15001262 - 15001311
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || ||||| |||||||||||||| |||||||||| |
|
|
| T |
15001262 |
ttggtggtggccggggtttgaaccttggaccttgcatattttatgcattg |
15001311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 15438527 - 15438478
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | | ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
15438527 |
ttggtggtggctgagattcaaaccccggaccttgcatatattatgcattg |
15438478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 15529831 - 15529782
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | | ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
15529831 |
ttggtggtggctgagattcaaaccccggaccttgcatatattatgcattg |
15529782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 19260566 - 19260615
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||| |||||||||||||||| |
|
|
| T |
19260566 |
ttggtggtggccggggtttgaaccccggaccttacatatattatgcattg |
19260615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 389 - 418
Target Start/End: Original strand, 23763294 - 23763323
Alignment:
| Q |
389 |
aaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23763294 |
aaccctggaccttgcatatattatgcattg |
23763323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 23852985 - 23852936
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
23852985 |
ttggtggtgggcgggattcaaaccacggaccttgcatatattatgcattg |
23852936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 24838157 - 24838206
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| |||||||||| |
|
|
| T |
24838157 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattg |
24838206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 26518867 - 26518908
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
26518867 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatt |
26518908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 27587295 - 27587246
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||||| |||||||| |
|
|
| T |
27587295 |
ttggtggtggccggggtttgaaccccggaccttgcatatatcatgcattg |
27587246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 30623367 - 30623318
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| |||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
30623367 |
ttggtcgtgttcggggttcgaaccccagaccttgcatatattatgcattg |
30623318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 38139313 - 38139272
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
38139313 |
ttggtggtgtccggggttcgaacccacgaccttgcatatatt |
38139272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 45396638 - 45396589
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45396638 |
ttggtggtggccgggattcgaacttcagaccttgcatatattatgcattg |
45396589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 989564 - 989612
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||| ||| ||||||| ||| |||||||||||| ||||| |
|
|
| T |
989564 |
ttggtggtgtccggaatttgaaccctagacattgcatatattaggcatt |
989612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 416
Target Start/End: Original strand, 26773800 - 26773836
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
26773800 |
cgggatttgaaccctagaccttgcatatattatgcat |
26773836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 417
Target Start/End: Complemental strand, 36122581 - 36122549
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
36122581 |
ttcgaaccctagaccttgcatatattatgcatt |
36122549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 58)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 38453339 - 38453290
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38453339 |
ttggtggtggctggggttcgaaccctggaccttgcatatattatgcattg |
38453290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 380 - 417
Target Start/End: Complemental strand, 53190358 - 53190321
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53190358 |
cgggattcgaaccctggaccttgcatatattatgcatt |
53190321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 56497595 - 56497644
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56497595 |
ttggtggtggccgggattcgaaccccagaccttgcatatattatgcattg |
56497644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 417
Target Start/End: Complemental strand, 43027362 - 43027318
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43027362 |
tggtgtccgggattcgaaccatgaaccttgcatatattatgcatt |
43027318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 3936698 - 3936652
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattg |
3936652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 25978388 - 25978342
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25978388 |
gtggtgtctgggattcgaacctcggaccttgcatatattatgcattg |
25978342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 34264703 - 34264753
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
34264703 |
ttggtggtgtctgggattcgaacccgggaccttgcatatatttatgcattg |
34264753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 371 - 417
Target Start/End: Original strand, 54294411 - 54294457
Alignment:
| Q |
371 |
ggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
54294411 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 373 - 418
Target Start/End: Original strand, 7371539 - 7371584
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7371539 |
tggtgtccggggttcgaaccccggaccttgcatatattatgtattg |
7371584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 11144652 - 11144701
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
11144652 |
ttggtggtgtccggggttcaaaccccagaccttgcatatattatgcattg |
11144701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 17976448 - 17976407
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17976448 |
ttggtggtgtccgggattcgaacccgcgaccttgcatatatt |
17976407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 418
Target Start/End: Complemental strand, 23775576 - 23775543
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23775576 |
ttcgaaccctggaccttgcatatattatgcattg |
23775543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 34546008 - 34545959
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || ||||| | |||||||||||||||||||||||||| |
|
|
| T |
34546008 |
ttggtggtgtccagggttcgatctctggaccttgcatatattatgcattg |
34545959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 34833993 - 34834042
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||||||||||||| |
|
|
| T |
34833993 |
ttggtggtgtccagtgttcgaaccccggaccttgcatatattatgcattg |
34834042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 46676485 - 46676534
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46676485 |
ttggtggtgtctgggggtcgaaccccggaccttgcatatattatgcattg |
46676534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 47806243 - 47806292
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
47806243 |
ttggtggtgttcggggttcgaaccccagaccttgcatatattatgcattg |
47806292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 51187618 - 51187577
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
51187618 |
ttggtggtgtccggggttcgaacccgggaccttgcatatatt |
51187577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 3580788 - 3580740
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
3580788 |
ttggtggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 413
Target Start/End: Complemental strand, 43078742 - 43078698
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatg |
413 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
43078742 |
ttggtggtggccgggattcgaatcctggatcttgcatatattatg |
43078698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 50442735 - 50442782
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
50442735 |
ttggtggtgtctgggattcgaacccag-accttgcatatattatgcatt |
50442782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 28116917 - 28116964
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
28116917 |
gtggtgtccggggttcgaacccgggaccttgcatatatttatgcattg |
28116964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 372 - 415
Target Start/End: Original strand, 42316814 - 42316857
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42316814 |
gtggtgaccgggattcgaacctcggaccttgcatatattatgca |
42316857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 371 - 418
Target Start/End: Complemental strand, 49949405 - 49949359
Alignment:
| Q |
371 |
ggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
49949405 |
ggtggtggccgggattcgaacccag-accttgcatatattatgcattg |
49949359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 379 - 418
Target Start/End: Original strand, 50650924 - 50650963
Alignment:
| Q |
379 |
ccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
50650924 |
ccgggattcgaaccctgaaccttacatatattatgcattg |
50650963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 7365798 - 7365748
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7365798 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
7365748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 7400280 - 7400330
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7400280 |
ttggtggtgtctggggttcgaacccaggaccttgcatatatttatgcattg |
7400330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 10006411 - 10006365
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10006411 |
gtggtggccggtattcgaaccccagaccttgcatatattatgcattg |
10006365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 11166757 - 11166711
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
11166757 |
gtggtgtccggggttcgaaccttagaccttgcatatattatacattg |
11166711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 13891067 - 13891117
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13891067 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
13891117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 16470367 - 16470329
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16470367 |
cggggttcgaaccctggaccttgcatattttatgcattg |
16470329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 18138337 - 18138287
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
18138337 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatttatgcattg |
18138287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 19588225 - 19588179
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcattg |
19588179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 19854636 - 19854590
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| | ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
19854636 |
gtggtgtccgaggttcgaaccccggatcttgcatatattatgcattg |
19854590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 23628836 - 23628786
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||| |||||||||| |
|
|
| T |
23628836 |
ttggtggtgtccggggttcgaaaccaggaccttgcatatatttatgcattg |
23628786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 27288545 - 27288595
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27288545 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
27288595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 29099696 - 29099746
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
29099696 |
ttggtggtgtctgggattcgaacccgcgaccttgcatatatttatgcattg |
29099746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 32139411 - 32139373
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32139411 |
gtggtgtccggggttcgaaccccggaccttgcatatatt |
32139373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Original strand, 37005517 - 37005555
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37005517 |
cgggattcgaaccctgaaccttacatatattatgcattg |
37005555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 40950947 - 40950897
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
40950947 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
40950897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 45019250 - 45019300
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45019250 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
45019300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 48283317 - 48283363
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| |||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
48283317 |
gtggtgtctgggatttgaaccctagaacttgcatatattatgcattg |
48283363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 49041971 - 49042017
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
49042017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 49125546 - 49125496
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
49125546 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatttatgcattg |
49125496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 49473716 - 49473670
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| | ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
49473716 |
gtggtgactggggttcgaaccccggaccttgcatatattatgcattg |
49473670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 50362145 - 50362175
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50362145 |
gaaccctggaccttgcatatattatgcattg |
50362175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 53274630 - 53274580
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
53274630 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
53274580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 55208559 - 55208609
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
55208559 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
55208609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 56564973 - 56565019
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| |||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
56564973 |
gtggtgttcggggttcgaaccctagaccttgcatattttatgcattg |
56565019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 11269768 - 11269719
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
11269768 |
ttggtggtgtctggggttcgaacccaagaccttgcatatattatgtattg |
11269719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 14542747 - 14542796
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| | || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
14542747 |
ttggtggtgttcagggttcgaaccccagaccttgcatatattatgcattg |
14542796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 20799381 - 20799430
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || || || |||||| |||||||||||||||||||||||| |
|
|
| T |
20799381 |
ttggtggtgaccagggtttgaaccccggaccttgcatatattatgcattg |
20799430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 21449886 - 21449934
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
21449886 |
ttggtggtggccgggttt-gaaccctggaccttgcatatatcatgcattg |
21449934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 414
Target Start/End: Original strand, 23304003 - 23304048
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgc |
414 |
Q |
| |
|
||||||||| ||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
23304003 |
ttggtggtggccggggttcgcaccccggaccttgcatatattatgc |
23304048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 380 - 417
Target Start/End: Original strand, 24664989 - 24665026
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24664989 |
cggggttcgaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 54857602 - 54857651
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| |||||||||| |
|
|
| T |
54857602 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattg |
54857651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 1701683 - 1701635
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||| | | |||||||| ||||||||||||||||||||||| |
|
|
| T |
1701683 |
ttggtggtgtctgaggttcgaacctcggaccttgcatatattatgcatt |
1701635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 416
Target Start/End: Complemental strand, 18094460 - 18094432
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcat |
416 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18094460 |
gaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 372 - 412
Target Start/End: Original strand, 51298686 - 51298726
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattat |
412 |
Q |
| |
|
|||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
51298686 |
gtggtgtccgggattcaaaccccgaaccttgcatatattat |
51298726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 50)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 13800741 - 13800692
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
13800741 |
ttggtggtgtccggggttcgaactgtggaccttgcatatattatgcattg |
13800692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 16792961 - 16793010
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
16792961 |
ttggtggtgaccggggtttgaaccctggaccttgcatatattatgcattg |
16793010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 1149059 - 1149105
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1149059 |
gtggtgtccagggttcgaaccctagaccttgcatatattatgcattg |
1149105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 27143117 - 27143071
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
27143117 |
gtggtgtccgggattcgaaccctagaccttacatatattatacattg |
27143071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 28130924 - 28130970
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
28130924 |
gtggtgtccgggattcaaaccccagaccttgcatatattatgcattg |
28130970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 53996370 - 53996324
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattg |
53996324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 14771402 - 14771357
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
14771357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 19468521 - 19468476
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19468521 |
tggtgtcccggattcgaaccacggaccttgcatatattatgcattg |
19468476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 25505689 - 25505737
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
25505689 |
ttggtggtgtccggg-ttcgaaccccagaccttgcatatattatgcattg |
25505737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 38130946 - 38130995
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
38130946 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
38130995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 38573560 - 38573609
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
38573560 |
ttggtggtgtccggggttcgaatcctagaccttgtatatattatgcattg |
38573609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 51614280 - 51614235
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
51614280 |
gtggtgtccgggattcgaacctcggaccttgcatatattttgcatt |
51614235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 366 - 418
Target Start/End: Complemental strand, 3100298 - 3100246
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| |||||||| |||||||||| |
|
|
| T |
3100298 |
ttgttggtggtggccggggttcaaaccctggactttgcatatgttatgcattg |
3100246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 22251447 - 22251495
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
22251447 |
ttggtggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 370 - 418
Target Start/End: Original strand, 46226066 - 46226113
Alignment:
| Q |
370 |
tggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
46226066 |
tggtggtgtctggggttcgaaccc-ggaccttgcatatattatgcattg |
46226113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 366 - 418
Target Start/End: Complemental strand, 53208047 - 53207995
Alignment:
| Q |
366 |
ttgttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
53208047 |
ttgttggtggtgtcaagggttcgaaccccagaccttgcatatattatgcattg |
53207995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 374 - 418
Target Start/End: Original strand, 53986537 - 53986581
Alignment:
| Q |
374 |
ggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
53986537 |
ggtgtccggggttcgaaccctggaccttgtatatattacgcattg |
53986581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 371 - 418
Target Start/End: Original strand, 25727956 - 25728003
Alignment:
| Q |
371 |
ggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
25727956 |
ggtggtggtcgggatttgaaccccggaccttgcatatattatgcattg |
25728003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 2909436 - 2909386
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
2909436 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
2909386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 7040885 - 7040835
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7040885 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
7040835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 8113552 - 8113598
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
8113552 |
gtggtggccgggattcgaaccgcggatcttgcatatattatgcattg |
8113598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 418
Target Start/End: Original strand, 14160272 - 14160314
Alignment:
| Q |
376 |
tgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
14160272 |
tgtccggggttcgaaccccggactttgcatatattatgcattg |
14160314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 14587458 - 14587508
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
14587458 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
14587508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 22347151 - 22347201
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
22347151 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
22347201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 27397602 - 27397648
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
27397602 |
gtggtgtccggggttcgaaccttagaccttgcatatattatacattg |
27397648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 28266786 - 28266741
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
28266786 |
gtggtgtccggg-tacgaaccccggaccttgcatatattatgcattg |
28266741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 29450663 - 29450613
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29450663 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
29450613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 32909291 - 32909337
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcatattttatgcattg |
32909337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 45599338 - 45599388
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45599338 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
45599388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 48545113 - 48545063
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
48545113 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
48545063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 48849753 - 48849799
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
48849799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 51882190 - 51882236
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcattg |
51882236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 52674787 - 52674737
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
52674787 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
52674737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 54510458 - 54510508
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
54510458 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
54510508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 54741807 - 54741757
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
54741807 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
54741757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 389 - 418
Target Start/End: Complemental strand, 3755393 - 3755364
Alignment:
| Q |
389 |
aaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3755393 |
aaccctggaccttgcatatattatgcattg |
3755364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 4216387 - 4216435
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||| || ||||||||| | |||||||||||||||||||||| |
|
|
| T |
4216387 |
ttggtggtgtccagggttcgaaccccg-accttgcatatattatgcattg |
4216435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 4601918 - 4601869
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||| |||||||||||| |
|
|
| T |
4601918 |
ttggtggtggccggggtttgaaccccggaccttgcatttattatgcattg |
4601869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 25340911 - 25340960
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| |||||||||| |
|
|
| T |
25340911 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattg |
25340960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 33771760 - 33771715
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
33771760 |
tggtggccgggattcaaaccgtggaccttgcatatattatacattg |
33771715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 35191804 - 35191853
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| |||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
35191804 |
ttggcggtgtctggggttcgaaccccagaccttgcatatattatgcattg |
35191853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 38361753 - 38361712
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
38361753 |
ttggtggtgtccggggttcgaacccgcgaccttgcatatatt |
38361712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 45334263 - 45334214
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
45334263 |
ttggtggtggtcgggatttgaaccccgaaccttgcatatattatgcattg |
45334214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Original strand, 46226016 - 46226061
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| |||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
46226016 |
tggtgttcggggttcgaactccggaccttgcatatattatgcattg |
46226061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 380 - 417
Target Start/End: Original strand, 48315022 - 48315059
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
48315022 |
cgggatttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 52119446 - 52119401
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattg |
52119401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 374 - 418
Target Start/End: Original strand, 8747228 - 8747272
Alignment:
| Q |
374 |
ggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| |||| |||||||||| ||||||| |||||||||||||||| |
|
|
| T |
8747228 |
ggtggccggtattcgaaccccggaccttacatatattatgcattg |
8747272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 38603032 - 38602984
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
38603032 |
ttggtggtggccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 418
Target Start/End: Original strand, 40575609 - 40575645
Alignment:
| Q |
382 |
ggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
40575609 |
ggatttgaaccccggaccttgcatatattatgcattg |
40575645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 55066587 - 55066635
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| |||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
55066587 |
ttggtggtggccgggatttgaaccccagaccatgcatatattatgcatt |
55066635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 372 - 415
Target Start/End: Original strand, 53767 - 53810
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgca |
415 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
53767 |
gtggtgtccgggattcgaaccccggaccttgcatgtattatgca |
53810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 17575 - 17529
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17575 |
gtggtgtccgggattcgaaccccaaaccttgcatatattatgcattg |
17529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 2726407 - 2726453
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattg |
2726453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 4450333 - 4450287
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcattg |
4450287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 26587463 - 26587417
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
26587463 |
gtggtggccgggattcgaacccagaaccttgcatatattatgcattg |
26587417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 655736 - 655785
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
655736 |
ttggtagtggccggggttcgaaccccggaccttgcatatattatgcattg |
655785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 12700408 - 12700457
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
12700408 |
ttggtggtggccggggttcaaaccctagaccttgcatatattatgcattg |
12700457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 21847268 - 21847219
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
21847268 |
ttggtggtggccgggattcgaaccccgtaccttgcatatattatgtattg |
21847219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 34474297 - 34474252
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
34474297 |
tggtggccggggttcgaaccatggaccttgcatatattatgcattg |
34474252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 3850228 - 3850178
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3850228 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
3850178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 8381184 - 8381230
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
8381184 |
gtggtatctggggttcgaaccctggaccttgcatatgttatgcattg |
8381230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 8569780 - 8569734
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattg |
8569734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 418
Target Start/End: Complemental strand, 9111110 - 9111072
Alignment:
| Q |
380 |
cgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcattg |
9111072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 18253345 - 18253375
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18253345 |
gaaccctggaccttgcatatattatgcattg |
18253375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 18593681 - 18593731
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
18593681 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
18593731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 24046631 - 24046681
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
24046631 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
24046681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 28472224 - 28472174
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
28472224 |
ttggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
28472174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 173135 - 173176
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
173135 |
ttggtggtgtccggggttcgaacccgtgaccttgcatatatt |
173176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 404237 - 404188
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||| ||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
404237 |
ttggtggtgtctggggttcgaacctcggacattgcatatattatgcattg |
404188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 370 - 418
Target Start/End: Complemental strand, 559729 - 559680
Alignment:
| Q |
370 |
tggtggtgtccgggattcgaaccctggaccttgcatata-ttatgcattg |
418 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
559729 |
tggtggtgtctggggttcgaacccgggaccttgcatatatttatgcattg |
559680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 410
Target Start/End: Original strand, 6018646 - 6018687
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
6018646 |
ttggtggtgtccggggttcgaacccacgaccttgcatatatt |
6018687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 12184579 - 12184534
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
12184579 |
gtggtggccgggatttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Original strand, 16204777 - 16204826
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
16204777 |
ttggtggtggtcgggatttgaaccccggaccttgcatacattatgcattg |
16204826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 418
Target Start/End: Original strand, 30960056 - 30960089
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
30960056 |
ttcgaaccctggaccttgcatatattaagcattg |
30960089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 418
Target Start/End: Complemental strand, 17145538 - 17145506
Alignment:
| Q |
386 |
tcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
17145538 |
tcgagccctggaccttgcatatattatgcattg |
17145506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 373 - 417
Target Start/End: Original strand, 30639417 - 30639461
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30639417 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcatt |
30639461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 4541 - 4496
Alignment:
| Q |
372 |
gtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
4541 |
gtggtgtccgggattcgaactctagaccttacatatattatgcatt |
4496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 369 - 410
Target Start/End: Complemental strand, 1477 - 1436
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatatt |
410 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1477 |
ttggtggtgtctggggttcgaaccctggaccttgcatatatt |
1436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 37605 - 37560
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcattg |
37560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 418
Target Start/End: Original strand, 34891 - 34924
Alignment:
| Q |
385 |
ttcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34891 |
ttcgaaccctggaccttgcatatattatgcattg |
34924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 379 - 418
Target Start/End: Complemental strand, 4530 - 4491
Alignment:
| Q |
379 |
ccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4530 |
ccgggatttgaaccctggaccttgcataaattatgcattg |
4491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 371 - 418
Target Start/End: Complemental strand, 18365 - 18318
Alignment:
| Q |
371 |
ggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
18365 |
ggtggtggccggaattcgaaccctggatcttgcatatattatacattg |
18318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 418
Target Start/End: Original strand, 72781 - 72811
Alignment:
| Q |
388 |
gaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
72781 |
gaaccctggaccttgcatatattatgcattg |
72811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 1602 - 1553
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||||||| | ||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1602 |
ttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattg |
1553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 6784 - 6739
Alignment:
| Q |
373 |
tggtgtccgggattcgaaccctggaccttgcatatattatgcattg |
418 |
Q |
| |
|
||||| ||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
6784 |
tggtggccggggttcgaaccatggaacttgcatatattatgcattg |
6739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 61557 - 61605
Alignment:
| Q |
369 |
ttggtggtgtccgggattcgaaccctggaccttgcatatattatgcatt |
417 |
Q |
| |
|
||||||||| ||||| || |||||||||||||| |||| |||||||||| |
|
|
| T |
61557 |
ttggtggtggccggggtttgaaccctggaccttacatacattatgcatt |
61605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University