View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_24 (Length: 324)
Name: NF1589_low_24
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_24 |
 | |
|
| [»] scaffold0086 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 307
Target Start/End: Original strand, 42592143 - 42592440
Alignment:
| Q |
10 |
catcatcaggccaccgagaagacacattagcgcattcacccaaatcaattggattgctgttaggggagaatttcctgtgaatattgttgtaatcaaggtt |
109 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42592143 |
catcattaggccacccagaagacacattagcgcattcacccaaatcaattggatttctgttagaggagaatttcctgtgaatattgttgtaatcaaggtt |
42592242 |
T |
|
| Q |
110 |
atgagtaaccctgatataccaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacttctgccagccttcgcaattgcttgcaatgcac |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| || || |||| |
|
|
| T |
42592243 |
atgagtagccctgatataccaactgtcagttgaagttgaatgaacttttgaatattgtgatattcacttctgccagccttcacaattggtttcagcgcac |
42592342 |
T |
|
| Q |
210 |
tgaaacatgtgatggatataccagatctctctctactatcaaatgttctgctaaaaaagttatgaattattcctacatcagctagctttagaacttct |
307 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||||||| ||| | | |||| | | ||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
42592343 |
tgaaacatgtgatagataaaccagaaccctctctactaccaattaatttgcttagagagttatgaactattcctgcatcagctatctttagaacttct |
42592440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 4092633 - 4092424
Alignment:
| Q |
10 |
catcatcaggccaccgagaagacacattagcgcattcacccaaatcaattggattgctgttaggggagaatttcctgtgaatattgttgtaatcaaggtt |
109 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||| |||| | |||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4092633 |
catcattaggccacctagaaggcacattagcacatttatccaaatcatttggattgctgttagaggagaatttcctgtgaaaattgttgtaatcaaggtt |
4092534 |
T |
|
| Q |
110 |
atgagtaaccctgatataccaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacttctgccagccttcgcaattgcttgcaatgcac |
209 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||| || |||||||| |
|
|
| T |
4092533 |
atgagtaaccctgatatgctaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacgtctgccggccttcacaattggttccaatgcac |
4092434 |
T |
|
| Q |
210 |
tgaaacatgt |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
4092433 |
tgaaacatgt |
4092424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 72
Target Start/End: Original strand, 29516 - 29544
Alignment:
| Q |
44 |
ttcacccaaatcaattggattgctgttag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29516 |
ttcacccaaatcaattggattgctgttag |
29544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University