View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_35 (Length: 250)
Name: NF1589_low_35
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 43182946 - 43183083
Alignment:
| Q |
1 |
ttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcggattatatcaattataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43182946 |
ttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcggattatatcaattataa |
43183045 |
T |
 |
| Q |
101 |
taccatttatgatgataatgtaaattccactgctctta |
138 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43183046 |
tactatttatgatgataatgtaaattccactgctctta |
43183083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University