View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_37 (Length: 249)
Name: NF1589_low_37
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 53 - 246
Target Start/End: Original strand, 26609248 - 26609441
Alignment:
| Q |
53 |
accaaataatttatttgtgcatgatgtttttaaaatataaacgtaaaaattgaataaaaattataatgcattctattttgtctactagccaaacaatgga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609248 |
accaaataatttatttgtgcatgatgtttttaaaatataaacgtaaaaattgaataaaaattataatgcattctattttgtctactagccaaacaatgga |
26609347 |
T |
 |
| Q |
153 |
atgtgaatggtgttccataatccattagtcaaaaatccaaacaatatataatgtgagtaggttccatttcattccattcaatttcatctcactc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26609348 |
atgtgaatggtgttccataatccattagtcaaaaatccaaacaatatataatgtgagtaggttccatttcattccattcaatttcatttcactc |
26609441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University