View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_43 (Length: 242)
Name: NF1589_low_43
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 121 - 226
Target Start/End: Original strand, 20018376 - 20018491
Alignment:
| Q |
121 |
atgaaaattaacttttagttgtttaaatatatcattacccttgcatctattgcaccactct----------tttttctttcaagatgtatacattcatac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20018376 |
atgaaaattaacttttagttgtttaaatatatcattacccttgcatctattgcaccactcttttttttttctttttctttcaagatgtatacattcatac |
20018475 |
T |
|
| Q |
211 |
caaacatttcccttaa |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20018476 |
caaacatttcccttaa |
20018491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University