View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_45 (Length: 239)
Name: NF1589_low_45
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 51964243 - 51964462
Alignment:
| Q |
4 |
agcacagattcacatatcaatatatcagataatgattatgcataattcatgtaatgcccgtttacttggatgaaatgagaagaatcaacagagtttttat |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51964243 |
agcacagattcacatatcaatgtatcagataatgattatgcataattcatgtaatgcccgtttacttggatgaaatgagaagaatcaacatagtttttat |
51964342 |
T |
|
| Q |
104 |
aatctttctgatttcatttcaaaataaaaagtgaaaaactaatctcagatttcctcttcaaatgatagacaaaggctaagtgacataataataagcatgc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51964343 |
aatctttctgatttcatttcaaaataaaaagtgaaaaactaatctcagatttcctcttcaaataatagactaaggctaagtgacataataataagcatgc |
51964442 |
T |
|
| Q |
204 |
ccccactcaatcgtgtcttg |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51964443 |
ccccactcaatcgtgtcttg |
51964462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University