View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_47 (Length: 238)
Name: NF1589_low_47
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 220
Target Start/End: Original strand, 30859710 - 30859767
Alignment:
| Q |
163 |
gaccgtggatattattaagatcttacgaccattgatgtctgcgtcattagggagaata |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
30859710 |
gaccgtggatgttattaagatcttacgaccattgatgtctgcatcgttagggagaata |
30859767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 98
Target Start/End: Original strand, 30859611 - 30859645
Alignment:
| Q |
64 |
gagaataattttggaaaaagaaaaagtagccatgc |
98 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30859611 |
gagaataattttgaaaaaagaaaaagtagccatgc |
30859645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University