View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_50 (Length: 237)
Name: NF1589_low_50
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_50 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 20272018 - 20272237
Alignment:
| Q |
18 |
gtgaattcttttcccgcccttttcatctaccgcgcgtcctcgaaggtttcaaaattatttcattttagattttatagtctgaagcatatttaatgttttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
20272018 |
gtgaattcttttcccgcccttttcatctatcgcgcgtcctcgaaggtttcaaaattattccattttagattttatagtccgaagcatatttaatgtcttt |
20272117 |
T |
|
| Q |
118 |
tcggttataaaacccaacaatattttaggttgaaataagttaggccgatttacagtttgtaaaggtcaagtccggtgtgtcacaaatttcaaagttcaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
20272118 |
tcggttataaaacccaacaatattttaggttgaaataagttaggccgatttacactttgtaaaggccaagtccggtgtgtcacaaatctcaaagttcaag |
20272217 |
T |
|
| Q |
218 |
tctgagatgtggcttgtcgt |
237 |
Q |
| |
|
||| ||||||||| |||||| |
|
|
| T |
20272218 |
tctaagatgtggcctgtcgt |
20272237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University