View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_55 (Length: 232)
Name: NF1589_low_55
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 5998056 - 5998276
Alignment:
| Q |
1 |
caaatacaaacta-ccttaaaaaca-tcaagttataaagttaaggttcataattcaagaacaatctaaacatccaatgcaagttcnnnnnnnnnnnnnn- |
97 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998056 |
caaatacaaactaaccttaaaaacaatcaagttataaagttaaggttcataattcaagaacaatctaaacatccaatgcaagttcaaaaagtaaaaaaaa |
5998155 |
T |
 |
| Q |
98 |
gtgaatcaccaattcaatacctcaaattacaggacaatgttaacttgtctgtgaaacaagaaaaattcagaaaagatctcaaaaccattattcattagtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998156 |
gtgaatcaccaattcaatacctcaaattacaggacaatgttaacttgtctgtgaaacaagaaaaattcagaaaagatctcaaaaccattattcattagtt |
5998255 |
T |
 |
| Q |
198 |
attttgttaagtgtgttctaa |
218 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
5998256 |
attttgttgagtgtgttctaa |
5998276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University