View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1589_low_58 (Length: 227)

Name: NF1589_low_58
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1589_low_58
NF1589_low_58
[»] chr4 (1 HSPs)
chr4 (7-198)||(51380368-51380559)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 198
Target Start/End: Original strand, 51380368 - 51380559
Alignment:
7 gtaagaagaaaaccggtggtgaatagaagaatggcgatgaggtgaagtaatagtgttatccacatcggccatatgtattgccactttccgatcttccgac 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51380368 gtaagaagaaaaccggtggtgaatagaagaatggcgatgaggtgaagtaatagtgttatccacatcggccatatgtattgccactttccgatcttccgac 51380467  T
107 gtccttcttccattgtcgttgaaatttaagattcgaatccttcctttgaattgagagatgagcgtgatatgcagttcaagcaaggtagagga 198  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
51380468 gtccttcttccattgtcgttgaaattgaagattcgaatccttcctttgaatttagagatgagcgtgatatgcagttcaagcaaggtagagga 51380559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University