View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1589_low_58 (Length: 227)
Name: NF1589_low_58
Description: NF1589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1589_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 198
Target Start/End: Original strand, 51380368 - 51380559
Alignment:
| Q |
7 |
gtaagaagaaaaccggtggtgaatagaagaatggcgatgaggtgaagtaatagtgttatccacatcggccatatgtattgccactttccgatcttccgac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51380368 |
gtaagaagaaaaccggtggtgaatagaagaatggcgatgaggtgaagtaatagtgttatccacatcggccatatgtattgccactttccgatcttccgac |
51380467 |
T |
 |
| Q |
107 |
gtccttcttccattgtcgttgaaatttaagattcgaatccttcctttgaattgagagatgagcgtgatatgcagttcaagcaaggtagagga |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51380468 |
gtccttcttccattgtcgttgaaattgaagattcgaatccttcctttgaatttagagatgagcgtgatatgcagttcaagcaaggtagagga |
51380559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University