View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1590-INSERTION-1 (Length: 132)

Name: NF1590-INSERTION-1
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1590-INSERTION-1
NF1590-INSERTION-1
[»] chr3 (3 HSPs)
chr3 (8-104)||(3701946-3702042)
chr3 (74-132)||(3702043-3702100)
chr3 (50-132)||(3713443-3713525)
[»] chr6 (1 HSPs)
chr6 (49-130)||(3520719-3520800)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 1e-45; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 3701946 - 3702042
Alignment:
8 ccttgtgcatggtggaaatggcttcgtcgcaggaatggtatgtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctac 104  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3701946 ccttgtgcatggtggaaatggcttcgtcgcagcaatggtatgtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctac 3702042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 3702043 - 3702100
Alignment:
74 gtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttgca 132  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3702043 gtgctccttggttt-aaggttcatgagctacatttatgtggcgatcctagtgttttgca 3702100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 3713443 - 3713525
Alignment:
50 tatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttgca 132  Q
    ||||| || |||||| | |||||||| ||| ||||||| |||| | |||||||||||||||| || |||||||||||||||||    
3713443 tatagtgggtatgcctgtactagagtactcattggtttaaaggatgatgagctacatttatgcggtgatcctagtgttttgca 3713525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 130
Target Start/End: Complemental strand, 3520800 - 3520719
Alignment:
49 gtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttg 130  Q
    ||||||||| |||||  ||||||| | |||||||||||| | || | | ||| |||||||||| || |||||||||||||||    
3520800 gtatagaggttatgcatggactagggcgctccttggtttgatggctgacgagatacatttatgcggtgatcctagtgttttg 3520719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University