View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590-INSERTION-1 (Length: 132)
Name: NF1590-INSERTION-1
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590-INSERTION-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 1e-45; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 3701946 - 3702042
Alignment:
| Q |
8 |
ccttgtgcatggtggaaatggcttcgtcgcaggaatggtatgtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3701946 |
ccttgtgcatggtggaaatggcttcgtcgcagcaatggtatgtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctac |
3702042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 3702043 - 3702100
Alignment:
| Q |
74 |
gtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttgca |
132 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3702043 |
gtgctccttggttt-aaggttcatgagctacatttatgtggcgatcctagtgttttgca |
3702100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 3713443 - 3713525
Alignment:
| Q |
50 |
tatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttgca |
132 |
Q |
| |
|
||||| || |||||| | |||||||| ||| ||||||| |||| | |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
3713443 |
tatagtgggtatgcctgtactagagtactcattggtttaaaggatgatgagctacatttatgcggtgatcctagtgttttgca |
3713525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 130
Target Start/End: Complemental strand, 3520800 - 3520719
Alignment:
| Q |
49 |
gtatagaggatatgccaggactagagtgctccttggttttaaggttcatgagctacatttatgtggcgatcctagtgttttg |
130 |
Q |
| |
|
||||||||| ||||| ||||||| | |||||||||||| | || | | ||| |||||||||| || ||||||||||||||| |
|
|
| T |
3520800 |
gtatagaggttatgcatggactagggcgctccttggtttgatggctgacgagatacatttatgcggtgatcctagtgttttg |
3520719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University