View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590-INSERTION-2 (Length: 122)
Name: NF1590-INSERTION-2
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590-INSERTION-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 3e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 45924423 - 45924525
Alignment:
| Q |
8 |
caacacaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatcagtatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45924423 |
caacacaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatcagaatt |
45924522 |
T |
|
| Q |
108 |
atc |
110 |
Q |
| |
|
||| |
|
|
| T |
45924523 |
atc |
45924525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 45936371 - 45936473
Alignment:
| Q |
8 |
caacacaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatcagtatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45936371 |
caacacaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatcagaatt |
45936470 |
T |
|
| Q |
108 |
atc |
110 |
Q |
| |
|
||| |
|
|
| T |
45936471 |
atc |
45936473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 26303239 - 26303329
Alignment:
| Q |
12 |
acaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatca |
102 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||| || |||||||||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
26303239 |
acaataagtgaaaagtgtggtgatccttatattgttgaagagaatccacatattcatgatcctgatgatgttttccctggccttgttatca |
26303329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 42240240 - 42240150
Alignment:
| Q |
12 |
acaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatca |
102 |
Q |
| |
|
||||| |||||||| |||||||| || ||||||||||| |||||||||||| ||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
42240240 |
acaataagtgaaaaatgtggtgatccatttattgtagaagagaatccacatattcatgacccagatgatgtttttccaggtcttgttatca |
42240150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 9 - 102
Target Start/End: Complemental strand, 12631365 - 12631272
Alignment:
| Q |
9 |
aacacaatcagtgaaaagtgtggtgacccgtttattgtagagaggaatccacatatccatgatccagatgatgttttccctggtcttgttatca |
102 |
Q |
| |
|
|||||||| ||||| |||||| ||| || |||||||| |||| ||||| ||||| ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
12631365 |
aacacaattagtgataagtgtaatgatccttttattgttgagaataatcctcatattcatgaccctgatgatgtcttccctggtcttgttatca |
12631272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University