View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15900_low_10 (Length: 286)
Name: NF15900_low_10
Description: NF15900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15900_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 271
Target Start/End: Original strand, 47369059 - 47369313
Alignment:
| Q |
17 |
actccaaatcatgctttataaatagataatgtacacatacggtggatttgccaaatctcttctaccacatacatcacgcttcaatggaattcctcttggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47369059 |
actccaaatcatgctttataaatagataatgtacacatacggtggatttgccaaatctcttctaccacatacatcacgcttcaatggaattcctcttggt |
47369158 |
T |
|
| Q |
117 |
cacttgcaaacttaacatgttataattcacagtctttgatggctggtctaattacaaaaagtataaatcaaagccttagagctataagttgtgtatgctg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47369159 |
cacttgcaaacttaacatgttataattcacagtctttgatggctggtctaattacaaaaagtataaatcaaagccatagagctataagttgtgtatgctg |
47369258 |
T |
|
| Q |
217 |
tcatagtatttgagaatttattttaccccttgagcagtggttcatataaggtttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47369259 |
tcatagtatttgagaatttattttaccccttgagcagtggttcatataaggtttt |
47369313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University