View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15902_low_2 (Length: 284)

Name: NF15902_low_2
Description: NF15902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15902_low_2
NF15902_low_2
[»] chr7 (2 HSPs)
chr7 (134-238)||(36589778-36589882)
chr7 (85-135)||(36589939-36589989)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 36589882 - 36589778
Alignment:
134 tccacttaatctcatcattcactagatcaacatcaagagccgctgaaaaccgtttcattatagcaagaaggaaatgaccttggttgtccctagtgcaagt 233  Q
    |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
36589882 tccatttaatctcatcattcagtagatcaacatcaagagccgctgaaaaccgtttcattatagcaagaaggaaatgaccttgcttgtccctagtacaagt 36589783  T
234 accaa 238  Q
    |||||    
36589782 accaa 36589778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 85 - 135
Target Start/End: Complemental strand, 36589989 - 36589939
Alignment:
85 tactttcaaccattattaaggattcattgcgcttgtttacatcttaaattc 135  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
36589989 tactttcaaccattattaaggattcattgcgcttgtttacatcttaaattc 36589939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University