View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15902_low_2 (Length: 284)
Name: NF15902_low_2
Description: NF15902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15902_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 36589882 - 36589778
Alignment:
| Q |
134 |
tccacttaatctcatcattcactagatcaacatcaagagccgctgaaaaccgtttcattatagcaagaaggaaatgaccttggttgtccctagtgcaagt |
233 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
36589882 |
tccatttaatctcatcattcagtagatcaacatcaagagccgctgaaaaccgtttcattatagcaagaaggaaatgaccttgcttgtccctagtacaagt |
36589783 |
T |
 |
| Q |
234 |
accaa |
238 |
Q |
| |
|
||||| |
|
|
| T |
36589782 |
accaa |
36589778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 85 - 135
Target Start/End: Complemental strand, 36589989 - 36589939
Alignment:
| Q |
85 |
tactttcaaccattattaaggattcattgcgcttgtttacatcttaaattc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36589989 |
tactttcaaccattattaaggattcattgcgcttgtttacatcttaaattc |
36589939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University