View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15903_low_1 (Length: 299)
Name: NF15903_low_1
Description: NF15903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15903_low_1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 13 - 299
Target Start/End: Original strand, 27008119 - 27008402
Alignment:
| Q |
13 |
gattattctttacaaaggtcaaagtgtatcaatctagttaaaaccctgcttataggattaactgaaaaatgcaagtcannnnnnncaactacccttattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
27008119 |
gattattctttacaaaggtcaaagtgtatcaatctagttaaaaccctgcttataggattaactgaaaaatgcaagtcatttttttcaactagccttattt |
27008218 |
T |
 |
| Q |
113 |
gattgggttggctcacgtgtcacacttctttgcagcaaccatgtattatgtggtagcatagctaatttaatcattcatcacaattcacagaaggcagaaa |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008219 |
gatttggttggctcacgtgtcacacttctttgcagcaac---gtattatgtggtagcatagctaatttaatcattcatcacaattcacagaaggcagaaa |
27008315 |
T |
 |
| Q |
213 |
ccataacataaatacttatatttaatattactttgcctaaaggttttttgaaactgttctggtttatattatgctttccatttggtc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008316 |
ccataacataaatacttatatttaatattactttgcctaaaggttttttgaaactgttctggtttatattatgctttccatttggtc |
27008402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University