View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15904_low_10 (Length: 240)
Name: NF15904_low_10
Description: NF15904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15904_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 6561824 - 6562042
Alignment:
| Q |
10 |
attatactttaatacatgtagggtttatctggtggaggcgccctattaatcattatcaggttacaatgtctaattctatcaggtatctcatctcaaatta |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| || ||||||||||||||| | |
|
|
| T |
6561824 |
attatactttaagacatgtagggtttatctg-tggaggcgccctattaatcagtatcaggttacaatgtctgattctataagctatctcatctcaaatca |
6561922 |
T |
|
| Q |
110 |
gcggctccagtcaaggaatatccacctaggccatcaaatgtgaagggttaaatcgaggagggaaatgtcaatgatac-ttagatacattgtagatatgca |
208 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6561923 |
acgactccagtcaaggaatatccgcctaggccatgaaatgtggagggttaaatcgaggaggaaaatgttaatgatactttagatacattgtagatatgca |
6562022 |
T |
|
| Q |
209 |
agttggttggaaatatggtc |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6562023 |
agttggttggaaatatggtc |
6562042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University