View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15904_low_9 (Length: 266)
Name: NF15904_low_9
Description: NF15904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15904_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 51 - 249
Target Start/End: Complemental strand, 41310130 - 41309928
Alignment:
| Q |
51 |
tggtcataaaatttattggtatgtctgtgt----agttgatgatattggtggacgatgctggtggagcttattcacgcattgatcactctccatggaatg |
146 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41310130 |
tggtcataaaatttattggtatgtctgcgtgtatagttgatgatattggtggacgatgctggtggagcttattcacgcattgatcactctccatggaatg |
41310031 |
T |
 |
| Q |
147 |
gatgtactttggctgattttgttatgcctttctttcttttcatcgttggtgttgccatagctcttgcattaaaggtaacaagttttccatcctctgctct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41310030 |
gatgtactttggctgattttgttatgcctttctttcttttcatcgttggtgtggccatagctcttgcattaaaggtaacaagttttccatcctctgctct |
41309931 |
T |
 |
| Q |
247 |
ctg |
249 |
Q |
| |
|
||| |
|
|
| T |
41309930 |
ctg |
41309928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 76 - 223
Target Start/End: Complemental strand, 41324792 - 41324645
Alignment:
| Q |
76 |
tgtgtagttgatgatattggtggacgatgctggtggagcttattcacgcattgatcactctccatggaatggatgtactttggctgattttgttatgcct |
175 |
Q |
| |
|
||||||| | |||||| |||| ||| | ||||||||||||||| ||||||||||||| | || ||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
41324792 |
tgtgtagataatgatactggtagacaaagctggtggagcttatccacgcattgatcatgccccgtgggatggatgtactttggctgattttgtaatgcct |
41324693 |
T |
 |
| Q |
176 |
ttctttcttttcatcgttggtgttgccatagctcttgcattaaaggta |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
41324692 |
ttctttcttttcattgttggtgttgccatagcccttgcattaaaggta |
41324645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 201
Target Start/End: Original strand, 928676 - 928791
Alignment:
| Q |
86 |
atgatattggtggacgatgctggtggagcttattcacgca-ttgatcactctccatggaatggatgtactttggctgattttgttatgcctttctttctt |
184 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||| | |||| |||||||||||||| | || | || |||||||||||||| || || ||| |
|
|
| T |
928676 |
atgatattggtggatgatgctggtgga-cttattccagcactcaatcattctccatggaatggtttaacaatagcagattttgttatgccatttttcctt |
928774 |
T |
 |
| Q |
185 |
ttcatcgttggtgttgc |
201 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
928775 |
tttattgttggtgttgc |
928791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 81 - 223
Target Start/End: Original strand, 27656415 - 27656557
Alignment:
| Q |
81 |
agttgatgatattggtggacgatgctggtggagcttattcacgcattgatcactctccatggaatggatgtactttggctgattttgttatgcctttctt |
180 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| | || ||||||||||||||||||||||||||||| ||||||||||| ||||||||||| || |
|
|
| T |
27656415 |
agttgatgatattggtggatgatggtggtggagcttatcctcgaattgatcactctccatggaatggatgtacattggctgatttcgttatgcctttttt |
27656514 |
T |
 |
| Q |
181 |
tcttttcatcgttggtgttgccatagctcttgcattaaaggta |
223 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
27656515 |
ccttttcattgttggagttgctatagctcttgcattaaaggta |
27656557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University