View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15905_low_8 (Length: 279)
Name: NF15905_low_8
Description: NF15905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15905_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 1178474 - 1178737
Alignment:
| Q |
1 |
aaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagctgctgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1178474 |
aaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagttgctgg |
1178573 |
T |
|
| Q |
101 |
cttcatatgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttctgagtatttacagagcataac |
200 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178574 |
catcatatgacgatcaaggcaactcgctcagcgattttcaaatttatgttttgaattactatagatgtttatggggttctgagtatttacagagcataac |
1178673 |
T |
|
| Q |
201 |
tcccttgtcaacctagctcaccgcactaggatatttttatttctttctttctgttagtaagtat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178674 |
tcccttgtcaacctagctcaccgcactaggatatttttatttctttctttctgttagtaagtat |
1178737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 6840417 - 6840208
Alignment:
| Q |
7 |
tacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagctgctggcttcat |
106 |
Q |
| |
|
||||||||||| || ||| |||||| ||||||| | ||| ||| |||||||||||||||| ||| |||||||||||||||||| |||||||| |||| | |
|
|
| T |
6840417 |
tacaacattggaccggttgagtggacttgttgcagacgtggtttttggaaggatggcgatcgagtttttggaggaaaggttggacagctgctgacttcgt |
6840318 |
T |
|
| Q |
107 |
atgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttctgagtatttacagagcataactccctt |
206 |
Q |
| |
|
|||| |||||||| ||| || ||||| | ||||| || | || || || |||||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
6840317 |
atgaagatcaaggaaacctgcatagcgaatctcaaacttctatt--gaagtatgatagatgtttattgggtcatgagtatttgcagagcataactccctt |
6840220 |
T |
|
| Q |
207 |
gtcaacctagct |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6840219 |
gtcaacctagct |
6840208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University