View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15906_high_41 (Length: 242)
Name: NF15906_high_41
Description: NF15906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15906_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 7365909 - 7365710
Alignment:
| Q |
20 |
gatcgaaatccttgctagagttgactcaaacaatcctctgcagttgaggtcagtatgcaagtggtggaaatcgcttgtcgttgatgatcaattcgtgcag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7365909 |
gatcgaaatccttgctagagttgactcaaacaatcctctgcagttgaggtcagtatgcaagtggtggaaatctcttgtcgttgatgatcaattcgtgcag |
7365810 |
T |
 |
| Q |
120 |
aagcaccttcacaaatccctcgccgacatcaccgatctactttccacggccacggaacaccgcaaatctttcgattcgcatcagattcccaaccagcttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
7365809 |
aagcaccttcacaaatccctcgccgacatcaccgatctactttccacggccacggaacaccgcaaatccttcgtttcgcatcagattcccaaccagcttc |
7365710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 7323347 - 7323273
Alignment:
| Q |
20 |
gatcgaaatccttgctagagttgactcaaacaatcctctgcagttgaggtcagtatgcaagtggtggaaatcgct |
94 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||| ||||||| ||||||| || ||||| | |||||| ||||| |
|
|
| T |
7323347 |
gatcgaaatcctttctagagttgattcaagcaatactctgcaattgaggtgcgtttgcaacttgtggaattcgct |
7323273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 128
Target Start/End: Complemental strand, 7348780 - 7348672
Alignment:
| Q |
20 |
gatcgaaatccttgctagagttgactcaaacaatcctctgcagttgaggtcagtatgcaagtggtggaaatcgcttgtcgttgatgatcaattcgtgcag |
119 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||||||| | | || |||| || ||||||| ||||||||| || || ||||| ||||||| || || |
|
|
| T |
7348780 |
gatcgaaatcctttctagagttgagtcaagcaatcctcaggaattaaggtgtgtttgcaagttgtggaaatcactagtttttgatactcaattcctggag |
7348681 |
T |
 |
| Q |
120 |
aagcacctt |
128 |
Q |
| |
|
|| |||||| |
|
|
| T |
7348680 |
aatcacctt |
7348672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 97
Target Start/End: Original strand, 7908036 - 7908112
Alignment:
| Q |
21 |
atcgaaatccttgctagagttgactcaaacaatcctctgcagttgaggtcagtatgcaagtggtggaaatcgcttgt |
97 |
Q |
| |
|
|||||||||||| ||||| |||| ||| | || |||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7908036 |
atcgaaatcctttctagatttgaaccaagcgattatctgcaattgaggtgcgtatgcaagtggtggaaatcacttgt |
7908112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University