View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15906_low_37 (Length: 250)
Name: NF15906_low_37
Description: NF15906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15906_low_37 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 36762241 - 36762479
Alignment:
| Q |
13 |
cagacgaatgttcaataaatttataattattggtgcattataaactagaaagctaaggaacgacaaaggtgcccttttttaaa-tcaatgatcatataag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36762241 |
cagacgaatgttcaataaatttataattattggtgcattataaactagaaagctaaggaacgacaaaggtgcccttttttaaaatcaatgatcatataag |
36762340 |
T |
|
| Q |
112 |
agatcataaatattagaaaaggatgtcaacgattttctaaagatatgttcacaaagattccacccagcatatttgcttaaaatggtaacttgcctagcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36762341 |
agatcataaatattagaaaaggatgtcaacgattttctaaagatatgttcacaaagattccacccagcatatttgcttaaaatggtaacttgcctagcaa |
36762440 |
T |
|
| Q |
212 |
tatcaagagaaaaccgtagaacttttgatggggacaaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36762441 |
tatcaagagaaaaccgtagaacttttgatggggacaaac |
36762479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University