View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15906_low_46 (Length: 238)
Name: NF15906_low_46
Description: NF15906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15906_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 50552527 - 50552322
Alignment:
| Q |
15 |
atgaagggaagcctgacgaactcttaaacccgaagaagaaaatttgggagacattgcaaacagagctgcacacaaatgaagagctagttgcatgctacaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50552527 |
atgaagggaagcctgacgaactcttaaacccgaagaagaaaatttgggagacattgcaaacagagctgcacacaaatgaagagctagttgcatgctacaa |
50552428 |
T |
 |
| Q |
115 |
aaatgttccacttaccacatcagctggtgtttgcaaggttttatccataactggatcaataaggtagatagagagaaagattgaaagataaaagacagca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50552427 |
aaatgttccacttaccacatcagctggtgtttgcaaggttttatccataactggatcaataaggtagatagagagaaagattgaaagataaaagacagca |
50552328 |
T |
 |
| Q |
215 |
tagttt |
220 |
Q |
| |
|
|||||| |
|
|
| T |
50552327 |
tagttt |
50552322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 154
Target Start/End: Complemental strand, 29763399 - 29763260
Alignment:
| Q |
15 |
atgaagggaagcctgacgaactcttaaacccgaagaagaaaatttgggagacattgcaaacagagctgcacacaaatgaagagctagttgcatgctacaa |
114 |
Q |
| |
|
||||||| || || || |||||||| || || ||||||||| ||||||||||||||||| || |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
29763399 |
atgaaggcaatccagatgaactcttgaatccaaagaagaaagtttgggagacattgcaagtcgatctgcacacgaatgagaagctagaggcatgctacaa |
29763300 |
T |
 |
| Q |
115 |
aaatgttccacttaccacatcagctggtgtttgcaaggtt |
154 |
Q |
| |
|
| | ||||| | |||||||||||||| |||||| |||| |
|
|
| T |
29763299 |
agacattccattgaccacatcagctggcatttgcacggtt |
29763260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University