View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15906_low_48 (Length: 230)
Name: NF15906_low_48
Description: NF15906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15906_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 4051935 - 4051862
Alignment:
| Q |
1 |
tgttacagtttgtgtgtttcttcatcatgatgcactatacaaggttgttgcattactctaaattgttgtgcttc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051935 |
tgttacagtttgtgtgtttcttcatcatgatgcactatacaaggttgttgcattactctaaattgttgtgcttc |
4051862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 4051799 - 4051747
Alignment:
| Q |
136 |
agctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051799 |
agctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatat |
4051747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 218
Target Start/End: Complemental strand, 4051734 - 4051704
Alignment:
| Q |
188 |
ttgataaaattagactctcaagcttcacctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4051734 |
ttgataaaattagactctcaagcttcacctt |
4051704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University