View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15906_low_51 (Length: 214)

Name: NF15906_low_51
Description: NF15906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15906_low_51
NF15906_low_51
[»] chr4 (1 HSPs)
chr4 (17-198)||(342488-342673)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 342673 - 342488
Alignment:
17 cactttgtccaccttcatcatcaaataaacataacttt----aagagtttcatagttgaatcaataaaacacaagaaatttctcaattgataacatatac 112  Q
    ||||||||||||||||||||||||||||||| ||||||    |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
342673 cactttgtccaccttcatcatcaaataaacaaaactttttttaagagtttcatatttgaatcaataaaacacaagaaattgctcaattgataacatatac 342574  T
113 tcacttcaccctcgaatgtaatagcatctccttgttctgtgaatcgttctctattcttcaagctatctagataatccaatgtctct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
342573 tcacttcaccctcgaatgtaatagcatctccttgttctgtgaatctttctctattcttcaagctatctagataatccaatgtctct 342488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University